Stem Cell

Cyclophilin A supports translation of intrinsically disordered proteins and affects haematopoietic stem cell ageing – Nature Cell Biology

Time Stamp: March 28, 2024 8:00 PM
Source Node: 565546

Mice

All animal experiments and care procedures were conducted at the Massachusetts General Hospital or Baylor College of Medicine facilities in accordance with the Institutional Animal Care and Use Committee (IACUC) protocols approved at each institution, in compliance with all relevant ethical regulations, and following guidelines from the National Institutes of Health Guide for the Care and Use of Laboratory Animals. The animal facilities were approved by the Association for Assessment and Accreditation for Laboratory Animal Care International (AAALAC). The generation of the Ppia^−/− mice has been described previously¹⁹. C57BL/6 and the congenic (CD45.1⁺) B6.SJL strain were purchased from The Jackson Laboratory (000664 and 002014). Ppia^+/−, Ppia^−/− and C57BL/6 wild-type animals were kept under pathogen-free conditions. All mice were housed in ventilated cages, on a standard rodent diet of chow and water ad libitum, under a 12-h light–dark cycle. Ppia^−/− mice were born at sub-Mendelian ratios but displayed no abnormal phenotype after multiple generations of backcrossing to the C57BL/6 genetic background. Animals with signs of sickness or infection were excluded from the study.

2D electrophoresis gels

We used the Zoom IPGRunner system (Invitrogen) to separate proteins in two dimensions. We isolated the HSPCs of young male and female C57BL/6J mice (four to eight months of age) and lysed them according to the manufacturer’s instructions with urea, CHAPS, dithiothreitol (DTT) and ampholytes. CyDyes DIGE fluors (minimal dyes) were used according to the vendor’s instructions (Amersham) with fluorophores Cy3 and Cy5 for post-lysis labelling to ensure that only 1–2% of lysines were labelled in a given protein. Labelling intensities were measured with a Typhoon FLA 9000 scanner and quantified with DeCyder 7.0 and ImageQuant software (GE Healthcare). We normalized the total protein abundance based on protein size and lysine concentration for spots with known identity by MS/MS. PPIA quantity was identical in two independent experiments using different fluorophores.

MS/MS

Characterization of the mouse HSPC proteome following 2D electrophoresis

Following trypsinolysis, we analysed digested peptides by reverse-phase liquid chromatography electrospray ionization MS using a Waters NANO-ACQUITY-UPLC system coupled to a Thermo LTQ linear ion-trap mass spectrometer. To identify proteins, we searched the MS/MS spectra against the non-redundant NCBI protein database using the SEQUEST program (http://proteomicswiki.com/wiki/index.php/SEQUEST). Two independent experiments were performed.

PPIA protein complex identification following 3XF-PPIA immunoprecipitation

Immunopurified samples were analysed by MS-based proteomics, as previously described⁶⁵. Minor modifications from the previously cited protocol are listed here. Digested peptides were injected into a nano-HPLC 1000 system (Thermo Scientific) coupled to an LTQ Orbitrap Elite mass spectrometer (Thermo Scientific) for the first repeat and a Q Exactive Plus (Thermo Scientific) mass spectrometer for second-repeat samples. Separated peptides were directly electro-sprayed into the mass spectrometer, controlled by Xcalibur software (Thermo Scientific) in data-dependent acquisition mode, selecting fragmentation spectra of the top 25 and 35 strongest ions for first samples and second samples, respectively. MS/MS spectra were searched against the target-decoy human RefSeq database (released January 2019, containing 73,637 entries) with the software interface and search parameters previously described⁶⁵. Variable modification of methionine oxidation and lysine acetylation was allowed. Protein abundance was calculated with the iBAQ algorithm, and the relative protein amounts between samples were compared with an in-house processing algorithm⁶⁶. Hits were limited to proteins that were identified using strict false discovery rate (FDR) levels following peptide spectral matching. Substrates with a preference for wild-type PPIA were defined as having at least 1.5-fold higher abundance of peptide spectral matches (PSMs) compared to mutant PPIA.

Tandem-mass-tag isobaric labelling for MS analysis of the mouse HSPC proteome

Whole BM was isolated from the femurs and tibias of four-month-old and 28-month-old male C57BL/6J mice or 10–12-month old PPIA heterozygous (Ppia^+/−) and knockout (Ppia^−/−) male mice. Magnetic depletion of lineage-positive haematopoietic cells was performed using the EasySep mouse haematopoietic progenitor cell isolation kit (Stem Cell Technologies), and lineage-depleted stem and progenitor cells were submitted to MS analysis. Cells were lysed with RIPA lysis buffer (Sigma-Aldrich) supplemented with XPert protease inhibitor cocktail (GenDepot), and 50-µg protein samples were subjected to acetone precipitation at −20 °C for 3 h. After centrifugation (12,000g for 5 min), pellets were denatured and reduced with 30 µl of 6 M urea, 20 mM DTT in 150 mM Tris-HCl, pH 8.0, at 37 °C for 40 min, then alkylated with 40 mM iodacetamide in the dark for 30 min. The reaction mixture was diluted tenfold using 50 mM Tris-HCl pH 8.0 before overnight digestion at 37 °C with trypsin (1:25 enzyme to substrate ratio). Digestions were terminated by adding an equal volume of 2% formic acid, and then desalted using Oasis HLB 1-ml reverse-phase cartridges (Waters). Eluates were dried by vacuum centrifugation. The protein digests were labelled by mixing with the appropriate TMT reagent according to the TMTsixplex Isobaric Label reagent protocol (Thermo Scientific). Following incubation at room temperature for 1 h, the reaction was quenched with hydroxylamine to a final concentration of 0.3% (vol/vol). After labelling, the individual reaction mixtures were combined, dried in a vacuum centrifuge to near dryness, then reconstituted in 0.5% formic acid containing 2% acetonitrile and desalted using Oasis HLB 1-ml reverse-phase cartridges (Waters).

An aliquot of TMT tryptic digest (in 2% acetonitrile/0.1% formic acid in water) was analysed by LC–MS/MS on an Orbitrap Fusion Tribrid mass spectrometer (Thermo Scientific) interfaced with an UltiMate 3000 binary RSLCnano system (Dionex). For trapping the sample, the UHPLC was equipped with an Acclaim PepMap 100 trap column (100 µm × 2 cm, C18, 3 µm) and washed with solvent A at a flow rate of 6 µl min⁻¹ for 7 min. Peptides were continuously separated onto an analytical C18 column (100-µm inner diameter × 30 cm, 3 µm) at flow rate of 350 nl min⁻¹. Gradient conditions were as follows: 5% for 8 min; 5–25% B for 200 min; 25–37% B for 22 min; 37–90% B for 10 min; 90% B held for 10 min (solvent A, 0.1% formic acid in water; solvent B, 0.1% formic acid in acetonitrile). The peptides were analysed using a data-dependent acquisition method. Orbitrap Fusion was operated with measurement of FTMS1 at a resolution of 120,000 (at m/z 200), a scan range of 380–1,500 m/z, AGC target 2E5 and a maximum injection time of 50 ms during a maximum 3-s cycle time. The most abundant multiply charged parent ions were selected for HCD MS2 at a resolution of 15,000 (at m/z 200) in the Orbitrap MS, with HCD NCE 40, a 1.6-m/z isolation window, AGC target 5E4 and a maximum injection time of 120 ms, and dynamic exclusion was employed for 40 s.

Proteome Discoverer v.1.4 (Thermo Scientific) with SEQUEST HT search engines was used for the spectra preprocessing, and HCD MS2 spectra were used for peptide identification and quantitation based on TMT reporter ions. The spectra were also searched against the decoy database using a target FDR of 1% or 5% using the Percolator. For trypsin, up to two missed cleavages were allowed. The MS tolerance was set to 10 ppm and the MS/MS tolerance to 0.02 Da. Oxidation of methionine was set as a variable modification, and carbamidomethylation on cysteine residues and TMT labelling on lysine and at the peptide N terminus were set as fixed modifications.

Label-free quantitative proteomic profiling of mouse HSPC global proteome (‘365’ profiling)

Whole BM was isolated from the femurs and tibias of three-month-old and 21-month-old male C57BL/6J mice. Magnetic depletion of lineage-positive haematopoietic cells was performed using the EasySep mouse haematopoietic progenitor cell enrichment kit (Stem Cell Technologies), and lineage-depleted stem and progenitor cells were submitted to MS analysis. Following sample lysis and overnight trypsin digestion, reconstituted peptidic fractions were loaded onto a nano-HPLC 1000 system (Thermo Fisher Scientific) coupled to an Orbitrap Fusion Lumos Tribrid mass spectrometer (Thermo Fisher Scientific), with identical acquisition settings as previously described⁶⁷. The trap and capillary HPLC columns have been described previously⁶⁵. The search of resultant MS/MS spectra against the target-decoy mouse RefSeq database (released June 2015, containing 58,549 entries) was carried out with the Proteome Discoverer 2.1 interface (Thermo Fisher) with the Mascot 2.4 algorithm (Matrix Science). The allowed variable modifications were methionine oxidation and protein N-terminal acetylation. The search settings were as follows: a precursor mass tolerance of 20 ppm, a maximum of two missed trypsin cleavages and a fragment ion mass tolerance of 0.5 Da. Assigned peptides were filtered with 1% FDR. The in-house iFOT data-processing algorithm^51,66 was used to calculated the label-free relative abundance of proteins in samples (Supplementary Data 1).

Gene Ontology analyses were performed with the DAVID bioinformatic database (https://david.ncifcrf.gov). The data represent 385 consistently identified proteins in 293T cells from two independent biological replicates. The degree of native protein disorder was determined using the openly available web interface IUPred2A (https://iupred2a.elte.hu/)^68,69. IUPred2A is a biophysics-based model that predicts intrinsically disordered protein regions in specific proteins with a confidence score between 0 and 1 for each residue, corresponding to the probability of the given protein being in a disordered state. A disordered region was defined as a protein segment having a confidence score greater than 0.5. The IDR computational analysis was free of redundant information to avoid over-representation of duplicated proteins in the MS/MS data.

Transplantations

All donor and recipient animals were gender-matched and between three and six months of age. Separate experiments were conducted in male and female mice with identical results. Experiments had a statistical power of >80%, and transplants were initiated with at least five animals per group. A priori power calculations were conducted to ascertain the required sample size for each of two equal-sized groups. The effect size was established at 15% of the pooled standard deviations, estimated at 10% based on historical data from our group. This analysis was predicated on performing a two-tailed independent samples test, appropriate for testing without a predetermined direction. Power was validated using post hoc verification. Transplant recipient animals were randomly assigned at the time of irradiation, and donor cells were pooled from up to three animals. Ppia^+/− animals were indistinguishable from wild-type animals in all experiments tested. Ppia^+/− mice were generated by backcrossing into C57BL/6J mice for over ten generations. Transplantation studies are representative of two independent biological replicates.

C57BL/6-B6.SJL wild-type mice (CD45.1⁺) were lethally irradiated with a Cs137 source at a single dose of 9.5 Gy up to 24 h before transplantation.

PB and BM cell analysis

Cells were injected into the tail vein of C57BL/6-B6.SJL recipient mice in 100 µl of PBS; 375,000 nucleated BM cells of male or female C57BL/6J Ppia^+/− or Ppia^−/− mice (CD45.2⁺) were co-injected with the same number of CD45.1⁺ competitor cells. PB chimerism was assessed at weeks 5, 8, 12 and 24 (shown are the 24-week analyses). Trendwise differences between Ppia knockout and heterozygous cells emerged at weeks 8 and 12 (P < 0.1) and became statistically significant at the 24-week analysis. Final BM collection occurred at week 28.

Serial transplantations

Equal numbers of BM cells (500,000 cells) from donor mice were mixed with 500,000 competitor cells from C57BL/6-B6.SJL wild-type mice and injected into lethally irradiated recipient mice. Two months after primary transplantation, 1,000,000 nucleated BM cells from the primary recipients were collected for a second time and again after two months for a third round of transplantation. Final evaluation was performed seven months after the third transplantation.

Rescue experiments

Lineage⁻, c-Kit⁺, Sca1⁺ cells were pooled from two 18-month-old C57BL/6 male mice and divided into two groups for lentiviral transduction overnight. The collected cells were grown in tissue culture incubators and serum-free medium (StemSpan SFEM, Stem Cell Technologies), supplemented with murine thrombopoietin (TPO; 20 ng ml⁻¹, PeproTech), stem cell factor (SCF; 10 ng ml⁻¹, PeproTech) and the β-catenin agonist CHIR99021 (250 nM, Stemgent). Concentrated lentivirus (pLVX-EF1alpha, Takara Bio) encoding mouse Ppia (‘rescue’) or the reverse complement (‘control’) was added to the cells. The next day, cells were washed in PBS, and 5,000 transduced HSPCs were injected along with 500,000 competing total BM cells in the recipient’s background into each irradiated recipient (four-month-old female C57BL/6-B6.SJL mice). The recipient mice were followed for six months with regular fluorescence-activated cell sorting (FACS) analysis of the PB to quantify reconstitution.

Cell analysis and FACS

First, freshly isolated PB and BM were used for analysis. BM cells were initially depleted of lineage-positive cells with MACS LD columns (Miltenyi Biotec), as previously described⁷⁰. The cells were then analysed with an LSR II instrument and isolated with an Aria I fluorescence-activated cell sorter (BD Biosciences).

The following antibody combinations were used for cell phenotyping: HSPC (c-Kit⁺, lineage⁻), LKS (c-Kit⁺, Sca1⁺, lineage⁻), CMP (c-Kit⁺, Sca1⁻, lineage⁻, CD16/32⁻, CD34⁺), CLP (c-Kit^int., Sca1^int., lineage⁻, CD127⁺, CD34⁺) and HSC (c-Kit⁺, Sca1⁺, lineage⁻, CD135⁻, CD34⁻, CD150⁺). Immunostainings were performed by incubating cells with anti-c-Kit (clone 2B8, BD Biosciences or Life Technologies), anti-Sca1 (clone D7, Caltag Medystems or Thermo Fisher Scientific), anti-CD16/32 (clone 93, eBioscience), anti-CD34 (clone RAM34, BD Biosciences), anti-CD135 (clone A2F10.1, BD Biosciences), anti-CD150 (clone TC15-12F12.2, BioLegend), anti-CD127 (clone SB/199, BioLegend) and anti-CD45.1/2 (clones A20 and 104, BioLegend) antibodies for 30 min (PB) or 60 min (BM) at 4 °C, before FACS analyses.

The antibodies used for lineage depletion were anti-CD11b (clone M1/70, BD Biosciences), anti-Ly-6G and Ly-6C (clone RB6-8C5, BD Biosciences), anti-CD8α (clone 53-6.7, BD Biosciences), anti-CD3ε (clone 145-2C11, BD Biosciences), anti-CD4 (clone GK1.5, BD Biosciences), anti-TER-199 (clone TER-119, BD Biosciences), anti-CD45R (clone RA3-6B2, BD Biosciences) and streptavidin (S32365, Thermo Fisher Scientific). The sources of the samples were blinded to the FACS analyst.

Cell culture and drug treatments

Biochemical assays were performed in 293T or HeLa cells, which were maintained at 37 °C in a humidified incubator containing 5% CO₂. Cell lines were purchased from ATCC (293T CRL-3216; HeLa CCL-2) or DMSZ (NB4 ACC-207; OCI-AML3 ACC-582), cultured with the medium composition recommended by the supplier, and monitored for signs of infection, including mycoplasma contamination. The ATCC cell lines were confirmed by short tandem repeat profiling and human papillomavirus positivity (HeLa).

Stable 293T or HeLa control and PPIA Kd1/Kd2 cell lines were generated using pLKO.1 lentiviral vectors encoding short-hairpin RNAs targeting the human PPIA protein (clone ID TRCN0000049171 (Kd1) or clone ID TRCN0000049170 (Kd2), Horizon Discovery) designed by The RNAi Consortium (TRC). Cell lines stably transduced with a pLKO.1-TRC empty vector encoding a non-targeting sequence (clone ID TRC TRCN0000241922, Horizon Discovery) served as controls. Following puromycin selection (2 µg ml⁻¹, Gibco, Fisher Scientific), PPIA knockdown efficiency was assessed by measuring PPIA protein expression by western blots in stably transduced cells (Extended Data Fig. 2d). The two constructs PPIA Kd1 and PPIA Kd2 showed >80% knockdown efficiency by immunoblot and were tested independently.

Control and PPIA Kd1 Hela cells were transfected with pcDNA3.1-PPIA vector or corresponding empty pcDNA3.1 control vector for 48 h. Following stress induction with sodium arsenite (50 µM, Sigma-Aldrich) for 1 h, immunostaining for G3BP1 protein, a marker of stress granule assembly, was performed using a rabbit polyclonal anti-G3BP1 antibody (cat. no. 13057-2-AP, Proteintech). The cells were mounted using Prolong gold antifade mounting medium containing 4′,6-diamidino-2-phenylindole (DAPI; Invitrogen) and were imaged at ×20 magnification on a Celldiscoverer 7 confocal microscope (Zeiss) operated with the ZEN Pro imaging software (Zeiss). The exposure time and gain were maintained at a constant level for all samples, and stress granule analysis was carried out with ImageJ software. Cell viability was measured on a Cellometer Auto 2000 automated cell counter with ViaStain acridine orange/propidium iodide staining solution (Nexcelom Bioscience). This staining solution discriminates live and dead nucleated cells using dual fluorescence. Cell viability was measured 1 h after stress induction with sodium arsenite.

Staining for P-bodies was performed in an identical manner in HeLa cells using an anti-DDX6 antibody (cat. no. 14632-1-AP, Proteintech). Visualization of nucleoli was conducted in OCI-AML3 cells (cat. no. ACC-582, DSMZ), following knock-in of mCherry into the endogenous NPM1 locus. Z-stacks were obtained at ×100 magnification (Celldiscoverer 7, Zeiss) in live cells following immobilization with Cell-Tak (Corning) at 37 °C in a humidified chamber with 5% CO₂. Before this, the cells were transduced and puromycin-selected for control or PPIA knockdown-vector 1 or treated for 24–48 h with PPIA inhibitor TMN355 (10 μM, Selleckchem). The size and roundness of nucleoli were quantified with Fiji⁷¹.

Generation of NPM1-mCherry knock-in OCI-AML3 cells

sgRNA design

For gene knock-in experiments in acute myeloid leukaemia (AML) cell lines, we utilized previously described methods⁷². We determined a protospacer sequence for NPM1 near the C-terminal exon 12 using the CRISPRscan platform⁷³ and a 20-nt guide RNA sequence. Synthetic single-guide RNAs (sgRNAs) for homology directed repair were purchased from Synthego.

Editing of NPM1 in OCI-AML3 cells

A double-stranded DNA template encoding the mCherry protein for HDR (NPM1_mCherry) was synthesized as a linear DNA fragment (Twist Biosciences). The HDR template was designed with ~100-bp and ~200-bp homology arms, with the left homology arm designed from NPM1 intron 11 DNA sequence and the right homology arm from the NPM1 3′ UTR DNA sequence, respectively. Following polymerase chain reaction (PCR) amplification (KAPA HiFI HotStart ReadyMix; Roche) with HDR Primer F and Primer R (Millipore Sigma), the amplicons were purified with AMPure XP beads (Beckman Coulter). To generate the fusion protein, stop codons were replaced with a GSG linker followed by mCherry and a stop codon.

Cas9-sgRNA pre-complexing and transfection

To obtain Cas9-sgRNA RNPs, 1 μg of Cas9 protein (PNA bio) was incubated with 1 μg of synthetic sgRNA (Synthego) for 20 min at room temperature, then 1 μg of PCR-amplified HDR DNA was added to the RNP mixture. 2.50 × 10⁵ OCI-AML3 cells were electroporated in buffer R (Thermo Fisher) using the Neon Transfection System. The following electroporation conditions were used for OCI-AML3 cells: 1,400 V, 10 ms, three pulses.

Sequences

NPM1-mCherry:

TTAACTCTCTGGTGGTAGAATGAAAAATAGATGTTGAACTATGCAAAGAGACATTTAATTTATTGATGTCTATGAAGTGTTGTGGTTCCTTAACCACATTTCTTTTCTTTTTTTTCCAGGCCATTCAGGACCTTTGGCAATGGAGAAAATCACTAGGAAGCGGAGTGAGCAAGGGCGAGGAGGATAACATGGCCATCATCAAGGAGTTCATGCGCTTCAAGGTGCACATGGAGGGCTCCGTGAACGGCCACGAGTTCGAGATCGAGGGCGAGGGCGAGGGCCGCCCCTACGAGGGCACCCAGACCGCCAAGCTGAAGGTGACCAAGGGTGGCCCCCTGCCCTTCGCCTGGGACATCCTGTCCCCTCAGTTCATGTACGGCTCCAAGGCCTACGTGAAGCACCCCGCCGACATCCCCGACTACTTGAAGCTGTCCTTCCCCGAGGGCTTCAAGTGGGAGCGCGTGATGAACTTCGAGGACGGCGGCGTGGTGACCGTGACCCAGGACTCCTCCCTGCAGGACGGCGAGTTCATCTACAAGGTGAAGCTGCGCGGCACCAACTTCCCCTCCGACGGCCCCGTAATGCAGAAGAAGACCATGGGCTGGGAGGCCTCCTCCGAGCGGATGTACCCCGAGGACGGCGCCCTGAAGGGCGAGATCAAGCAGAGGCTGAAGCTGAAGGACGGCGGCCACTACGACGCTGAGGTCAAGACCACCTACAAGGCCAAGAAGCCCGTGCAGCTGCCCGGCGCCTACAACGTCAACATCAAGTTGGACATCACCTCCCACAACGAGGACTACACCATCGTGGAACAGTACGAACGCGCCGAGGGCCGCCACTCCACCGGCGGCATGGACGAGCTGTACAAGTAG

HDR Primer F:

GTTCACATTTTTATGACTGATTAAAGTGTTTGGAATTAAATTACATCTGAGTATAAATTTTCTTGGAGTCATATCTTTATCTAGAGTTAACTCTCTGGTGGTAGAATGAAAAATAGATGT

HDR Primer R:

TTCTCACTCTGCATTATAAAAAGGACAGCCAGATATCAACTGTTACAGAAATGAAATAAGACGGAAAATTTTTTAACAAATTGTTTAAACTATTTTCCTACTTGTACAGCTCGTCCATGC

sgNPM1wt:

UCCAGGCUAUUCAAGAUCUC

Overview of cell type usage across figures

Figures 1, 2, 5d and 6 are based on freshly isolated murine HSPCs and HSCs. Figures 3b–e and 4c show experiments with 293T cells. Figures 4e–g and 5a,b were performed in HeLa cells. Figure 5c was conducted with OCI-AML3 cells following knock-in of mCherry at the 3′ end of NPM1.

Immunoprecipitations and western blots

Immunoprecipitations of 3XF-PPIA and 3XF-Mutant PPIA transiently transfected cells were performed in 293T cells (one T175 flask per condition). 3XF-Mutant PPIA (G104A mutant) has reduced catalytic activity due to blocked substrate access to the active site³². At 48 h post transfection, 293T cells were washed twice with cold PBS and mechanically collected with a cell scraper. Cells were lysed using PBS buffer supplemented with 1% Triton X-100 and Xpert protease inhibitor cocktail (GenDepot) for 10 min, with end-over-end rotation. Cell lysates were centrifuged at 4,000g for 4 min at 4 °C. The supernatant was collected and immunoprecipitation was performed on the cytoplasmic fraction of the cells. For immunoprecipitation, the cell lysate was mixed with 4 µl of mouse monoclonal anti-FLAG antibody (clone M2, 1 µg µl⁻¹, Millipore Sigma) in a total volume of 900 µl for 1 h 30 min at 4 °C, then 50 µl of Protein G Dynabeads (Thermo Fisher) were added to the cell lysate for 3 h 30 min with end-over-end rotation. The beads were washed twice with 800 µl of ice-cold PBS for 5 min with end-over-end rotation at 4 °C, and the protein complexes were eluted with 50 µl of 3XFLAG peptide (Sigma-Aldrich) for 5 min at room temperature. Immunoblotting against a fraction of the lysate was used to validate that the expression levels of 3XF-PPIA and 3XF-Mutant PPIA were equal.

Immunoprecipitation against endogenous PPIA was performed in parental HeLa cells (two T175 flasks per condition). The cells were washed three times with ice-cold PBS, harvested mechanically, and pelleted at 1,200g for 5 min at 4 °C. The cells were lysed using IP lysis buffer (PBS supplemented with 1% Triton X-100 and 1% Xpert Protease Inhibitor Cocktail) and centrifuged at 4,000g for 5 min at 4 °C. The supernatant was collected and a fraction was stored at −80 °C for input material. The lysate was then mixed with either 10 µg of anti-PPIA antibody (ab58144, Abcam) or normal mouse IgG₁ (IgG, immunoglobulin; Cell Signaling Technology) as a negative control in a total volume of 950 µl. Incubations with target antibody or isotype control were carried out for 1 h 15 min with end-over-end rotation at 4 °C, followed by incubation with 125 µl of Protein G Dynabeads overnight at 4 °C. The next day, the Protein G beads were washed once with 850 µl of ice-cold lysis buffer for 5 min with end-over-end rotation at 4 °C, followed by a similar wash with 850 µl of ice-cold PBS supplemented with 1% Xpert protease inhibitor cocktail. The protein complexes were eluted with 60 µl of elution buffer (50 mM Tris-HCl, pH 7.4, 1% SDS, 10 mM EDTA) by vortexing and applying three incubation cycles of 5 min at 65 °C.

Western blots were performed with a rat monoclonal anti-HA high-affinity antibody (clone 3F10, Millipore Sigma), a rabbit polyclonal anti-histone H3 antibody (ab1791, Abcam), a rabbit polyclonal anti-cyclophilin A antibody (2175, Cell Signaling Technology), a rabbit polyclonal anti-PABPC1 antibody (4992, Cell Signaling Technology), a rabbit polyclonal anti-DDX6 antibody (14632-1-AP, Proteintech), a rabbit polyclonal anti-G3BP1 antibody (13057-2-AP, Proteintech), a rabbit polyclonal anti-NPM1 antibody (10306-1-AP, Proteintech), a mouse monoclonal anti-β-tubulin antibody (86298, Cell Signaling Technology) and a mouse monoclonal anti-glyceraldehyde 3-phosphate dehydrogenase (anti-GAPDH) antibody (ab204481, Abcam).

Pulsed SILAC

The workflow of the pulsed SILAC experiment performed in this study is described in Fig. 4a. First, control and PPIA Kd HeLa or 293T cells were cultured for five days in standard DMEM (containing light/unlabelled variants of lysine and arginine). Once the cells reached a similar confluence level (~50%), heavy isotope (¹³C-¹⁵N-lysine and ¹³C-¹⁵N-arginine)-containing DMEM (Thermo Fisher Scientific) was added in excess to the cells for 24 h. The amino-acid concentrations were 0.46 mM l-lysine-2HCl and 0.47 mM l-arginine-HCl. Cells were collected and 100 µg of protein cell lysates from each cell type and condition were subjected to acetone precipitation, then denaturation, reduction and alkylation before overnight in-solution digestion at 37 °C with trypsin to generate peptides for MS. Digestions were terminated by adding an equal volume of 2% formic acid, and then desalted with Oasis HLB 1-ml reverse-phase cartridges (Waters) according to the vendor’s protocol.

LC–MS/MS analysis

An aliquot of the tryptic digest was analysed by LC–MS/MS on an Orbitrap Fusion Tribrid mass spectrometer (Thermo Scientific) interfaced with an UltiMate 3000 Binary RSLCnano System (Dionex), as previously described⁷⁴. In our experiments, dynamic exclusion was employed for 40 s.

Data processing and analysis

The raw proteomic files were processed with the Proteome Discoverer 1.4 software (Thermo Scientific), and the MS/MS spectra were searched against the UniProt Homo sapiens database using the SEQUEST HT search engine. The spectra were also searched against the decoy database using a peptide target FDR set to <1% and <5%, for stringent and relaxed matches, respectively. The search parameters allowed for a maximum of two missed trypsin cleavages, and the MS/MS tolerance was set at 0.6 Da. Carbamidomethylation on cysteine residues was used as a fixed modification, and oxidation of methionine as well as SILAC heavy arginine (¹³C₆–¹⁵N₄) and SILAC heavy lysine (¹³C₆–¹⁵N₂) were set as variable modifications. Quantification of SILAC pairs was performed with the Proteome Discoverer software. Precursor ion elution profiles of heavy versus light peptides were determined with a MS tolerance of 3 ppm. The area under the curve was used to determine a SILAC ratio for each peptide.

De novo translation assay

Haematopoietic stem cells (c-Kit⁺, Sca1⁺, lineage⁻, CD135⁻, CD34⁻) were collected from male and female C57BL6/J mice, four to six months of age, and expanded ex vivo using a previously published protocol⁷⁵. Following 24-h treatment with PPIA inhibitor TMN355 (10 μM) or DMSO control, the translation rates were measured by microscopy with a fluorescent puromycin analogue (Click-IT Plus OPP, Alexa 488 picolyl azide, Thermo Fisher) following a 2-h pulse with the bio-orthogonal label according to the vendor’s protocol. Quantification was performed at ×40 magnification (Celldiscoverer 7, Zeiss) using Fiji software⁷¹.

PLA

Whole BM was obtained from the hind-limb long bones and hip bones of young and old male C57BL/6J mice (five months old and 23 months old, respectively). Lineage-positive cells were isolated using the Direct Lineage Cell depletion kit (Miltenyi Biotec) and magnetically depleted with an AutoMACS Pro Separator (Miltenyi Biotec). The lineage-negative fraction was resuspended at a concentration of 10⁸ cells per millilitre and stained on ice for 15 min with the combination of antibodies characterizing HSCs described in the ‘Cell analysis and FACS’ section. Cell sorting was carried out on an Aria II FACS instrument (BD Biosciences). Finally, isolated HSCs were cytospinned, attached onto a Cellview slide (543979, Greiner Bio-one) in the presence of Cell-Tak (Corning), and fixed in 4% paraformaldehyde.

To quantify PPIA expression, PLAs were performed on isolated HSCs with the Duolink in Situ Red Starter Kit Mouse/Rabbit (DUO92101, Millipore Sigma), adapting the vendor’s protocol for HSCs. Briefly, HSCs were permeabilized with PBS + 0.5% Triton X-100 for 7 min, washed with PBS, and blocked in 5% donkey serum for 30 min at room temperature. After a short wash in PBS, the slides were incubated in a humidity chamber for 1 h at 37 °C with Duolink blocking solution. The primary antibodies (mouse anti-cyclophilin A antibody, ab58114, and rabbit anti-cyclophilin A antibody, ab41684; both from Abcam) were applied overnight at 4 °C in a humidity chamber. To quantify interactions between PPIA and its substrates, the mouse anti-cyclophilin A antibody was used in combination with rabbit anti-PABPC1, anti-DDX6 or anti-NPM1 antibodies (Proteintech 10970, 14632, 10306) in HSCs derived from mice, six to eight months of age. After washing the samples twice with Duolink buffer A, diluted anti-mouse PLUS and anti-rabbit MINUS PLA probes were added to the samples for 1 h at 37 °C in a pre-heated humidity chamber. Following two washes with buffer A, the cells were incubated with a DNA ligase previously diluted in Duolink ligation buffer for 30 min at 37 °C. The samples were washed twice in Duolink buffer A under gentle shaking, and incubated with a diluted DNA polymerase solution for 1 h 40 min at 37 °C in the dark. Finally, the slides were rinsed twice in 1× wash buffer B for 10 min and once in 0.01× wash buffer B for 1 min at room temperature and mounted with Duolink in situ mounting medium containing DAPI. For each antibody, a negative control experiment was performed where only one antibody or no antibody was incubated with the PLA probes. Fluorescence was visualized with a Celldiscoverer 7 confocal microscope (Zeiss) at ×100 magnification, and the images were processed to include background subtraction and orthogonal projection with ZEN Pro imaging software (Zeiss). The analyst was blinded to the origin of the samples during PLA staining and spot counting. An average of 90 cells per condition were counted, and the shown fluorescence microscopy images are representative of two independent biological replicates.

Misfolded protein quantification

To quantify the relative abundance of misfolded protein aggregates in HeLa cells, we utilized a Proteostat Aggresome detection kit (ENZ-51035-K100, Enzo Life Sciences). The Proteostat aggresome detection assay was performed according to the manufacturer’s instructions. Briefly, cells seeded on glass slides were washed with PBS, fixed with 4% formaldehyde for 30 min at room temperature, permeabilized (0.5% Triton X-100, 3 mM EDTA) for 30 min on ice under gentle shaking, and stained with Proteostat dye (1:20,000 dilution) for 1 h at room temperature. Nuclei were counterstained with DAPI. Cells treated with 10 µM MG132 (proteasome inhibitor) for 16 h were used as a positive control. Samples stained with DAPI only served as a background control for Proteostat quantification. The cells were imaged with an Olympus Fluoview FV3000 confocal microscope with excitation/emission (Proteostat) = 488/632 nm and (DAPI) = 350/435 nm. Signal quantification was performed with Fiji software⁷¹.

RNA sequencing

For a young versus old comparison, wild-type HSPCs were isolated from the hind-limb long bones of male C57BL/6J mice, aged four to six months or 31–33 months, respectively. c-Kit⁺ cells were stained and magnetically isolated from the lineage-depleted cell suspension using the EasySep mouse CD117 (c-Kit) positive selection kit (Stem Cell Technologies), following the manufacturer’s instructions. After overnight growth in serum-free medium (StemSpan SFEM, Stem Cell Technologies), supplemented with murine TPO (20 ng ml⁻¹, PeproTech), SCF (10 ng ml⁻¹, PeproTech) and the β-catenin agonist CHIR99021 (250 nM, Stemgent), HSPCs were collected as cell pellets. Immediately after collection, RNA extraction was carried out with the RNeasy Plus Mini kit with genomic DNA Eliminator columns (QIAGEN) in combination with on-column DNaseI digestion (QIAGEN), according to the vendor’s protocol.

Total RNA-seq libraries were generated and prepared for multiplexing on the Illumina platform with the TruSeq stranded total RNA library prep (Illumina) according to the manufacturer’s protocol. The libraries included ERCC ExFold RNA spike-in mixes (Thermo Fisher Scientific) to assess the platform dynamic range. RNA spike-in mixes confirmed high fidelity between two independent next-generation sequencing (NGS) runs (R² = 0.991 and 0.943, respectively; Supplementary Data 2). The resultant libraries were quality-checked on a Bioanalyzer 2100 instrument (Agilent) and quantified with a Qubit fluorometer (Thermo Fisher Scientific). Further quantification of the adapter ligated fragments and confirmation of successful P5 and P7 adapter incorporations were assessed with the KAPA universal library quantification kit for Illumina (Roche), run on a ViiA7 real-time PCR system (Applied Biosystems). Multiplexed and equimolarly pooled library products were re-evaluated on the Bioanalyzer 2100 and diluted to 18 pM for cluster generation by bridge amplification on the cBot system. The libraries were then loaded onto a rapid run mode flowcell v.2, followed by paired-end 100-cycle sequencing run on a HiSeq2500 instrument (Illumina). The PhiX Control v3 adapter ligated library (Illumina) was spiked-in at 2% by weight to ensure balanced diversity and to monitor clustering and sequencing performance. We obtained a minimum of 50 million reads per sample.

For the Ppia heterozygous versus knockout comparison, cells were isolated from mice, aged 10–12 months, as outlined above, and immediately subjected to RNA isolation (without overnight culture). Total RNA libraries were prepared using the SMARTer Stranded Total RNA-Seq kit v.2 (Takara Bio, 634418) and Unique Dual Index kit (Takara Bio, 634752). Paired-end sequencing was performed for 150 cycles using an Illumina NovaSeq 6000 system.

Data processing

Fastq file generation was achieved with the Illumina’s BaseSpace Sequence Hub. Demultiplexing was based on sample-specific barcodes. All bioinformatic analyses were performed with Linux command line tools. After removing the short sequence reads that did not pass quality control and discarding reads containing adaptor sequences with Cutadapt v.1.12⁷⁶, sequence reads were assembled and mapped against the mouse MM9 reference genome (Genome Reference Consortium) with TopHat2/Bowtie2 v.2.1.0⁷⁷. Gene expression changes were quantified with Cufflinks and Cuffdiff v.2.1.1⁷⁸, and data were normalized by calculating the fragments per kilobase per million mapped reads (FPKM). Analysis of murine RNA-seq data was validated by two independent biological replicates (young versus old) or three independent replicates (Ppia heterozygous versus knockout).

Statistics

All statistical analyses were performed using Stata v.15.1 and GraphPad Prism v.10 software. Unsupervised hierarchical clustering was performed with Morpheus using default parameters, and gene set enrichment analyses were performed with GSEA v.4.3.2 based on gene set permutations^79,80. The gene sets are available in Supplementary Data 8. Dashed lines mark medians and dotted lines represent the lower and upper quartiles in violin plots. Comparisons for MS were pruned for low-scoring peptides and rank-normalized. The treatment designation or cell genotype in microscopy-based or FACS analyses was blinded to the person performing quantification to reduce experimental bias. No data points or animals were excluded from the analysis of completed experiments. Randomization was not feasible within the experimental design. We did not formally test data for normality and homoscedasticity; however, we employed the Wilcoxon rank-sum test, which utilizes ranks rather than actual values, allowing robust statistical calculations even when distributions are skewed and variances are unequal.

Software

All open-source and commercial software and proteomic databases used to analyse MS/MS data, RNA-sequencing data and microscopy pictures are described in the Methods. All statistical analyses were performed using Stata v.15.1 and GraphPad Prism v.10. Image analysis was performed with Fiji/ImageJ 2.00/1.52p and ZEN Pro 3.1. The 2D gel captures were analysed with DeCyder 7.0 and ImageQuant (GE Healthcare). Pulsed SILAC data were analysed with Qlucore Omics Explorer 3.5 software. FACS data were analysed with FlowJo v.10. Gene set enrichment analyses were performed with GSEA v.4.3.2. The 3D molecular structure of the PPIA protein was visualized with PyMOL v.2.5.2 (licensed by A.C.). Figures 1c,g,2a,4a and 6d were created with BioRender.com (licensed by L.M.).