{"id":390195,"date":"2023-12-20T19:00:00","date_gmt":"2023-12-21T00:00:00","guid":{"rendered":"https:\/\/platohealth.ai\/trex1-is-required-for-microglial-cholesterol-homeostasis-and-oligodendrocyte-terminal-differentiation-in-human-neural-assembloids-molecular-psychiatry\/"},"modified":"2023-12-22T17:47:38","modified_gmt":"2023-12-22T22:47:38","slug":"trex1-is-required-for-microglial-cholesterol-homeostasis-and-oligodendrocyte-terminal-differentiation-in-human-neural-assembloids-molecular-psychiatry","status":"publish","type":"post","link":"https:\/\/platohealth.ai\/trex1-is-required-for-microglial-cholesterol-homeostasis-and-oligodendrocyte-terminal-differentiation-in-human-neural-assembloids-molecular-psychiatry\/","title":{"rendered":"TREX1 is required for microglial cholesterol homeostasis and oligodendrocyte terminal differentiation in human neural assembloids – Molecular Psychiatry","gt_translate_keys":[{"key":"rendered","format":"text"}]},"content":{"rendered":"
All patient samples were obtained from individuals enrolled in a retrospective natural history study [Myelin Disorders Bioregistry at Children\u2019s Hospital of Philadelphia (IRB#14-011236)]. Informed consent was obtained from all subjects.<\/p>\n
Inclusion criteria were known AGS-related genotypes and availability of cholesterol measurements. Individuals without a known genotype or with absence of medical records were excluded.<\/p>\n
The following variables were collected for all samples as available: age at sample collection, genotype, and cholesterol panel results. Laboratory values were extracted from electronic medical records. Upper and lower limits of normal were collected as well. When patients were enrolled in a Janus kinase inhibitor study, only baseline values were collected. When multiple values were available, the first available level was provided.<\/p>\n
Isogenic mutagenized H9 ESCs have been characterized previously [15<\/a>]. Pluripotent stem cell colonies were cultured and passaged manually as small colonies on Matrigel-coated dishes (BD Biosciences, San Jose, CA, USA) with mTeSR\u2122 Plus medium (StemCell Technologies, Vancouver, Canada).<\/p>\n All cellular and tissue cultures were routinely tested for mycoplasma. Antibiotic-free media supernatants were collected, centrifuged, and resuspended in saline buffer. Ten microliters of each sample were assayed in a PCR with the following primers:<\/p>\n Forward: GGCGAATGGGTGAGTAAC;<\/p>\n Reverse: CGGATAACGCTTGCGACCT.<\/p>\n Mycoplasma-positive samples were immediately discarded and not used in the study.<\/p>\n A protocol previously developed [39<\/a>] and adapted from [83<\/a>] and [84<\/a>] was used to differentiate PSCs to microglia. Prior to initiating differentiation, PSC colonies were gently dissociated using a 1:1 solution of Accutase\u24c7<\/span><\/sup> (Innovative Cell Technologies, San Diego, CA, USA) and PBS for 20\u2009min at 37\u2009\u00b0C and seeded at a concentration of about 800,000 cells per 10\u2009cm matrigel-coated dish. Colonies were maintained in mTeSR\u2122 Plus medium for about three days until the dish was about 70% confluent. The differentiation protocol consists of four sequential steps: primitive streak cell induction, hemangioblast-like hematopoietic precursors, myeloid differentiation, and monocyte generation. In the first step, primitive streak cells were induced by the addition of Bone Morphogenetic Protein – 4 (BMP-4, 80\u2009ng\/mL, Peprotech) to the mTeSR\u2122 Plus medium with daily media changes for three days. In the second step (Day 4), cells were pushed to differentiate into hemangioblast-like hematopoietic precursors with the addition of a cocktail of three factors [Vascular Endothelial Growth Factor 121 (VEGF, 80\u2009ng\/mL, Peprotech), Stem Cell Factor (SCF, 100\u2009ng\/mL, Gemini Bio), and Fibroblast Growth Factor basic (bFGF, 25\u2009ng\/mL, Life Technologies)] in Microglial Precursor Differentiation Media (MPDM) which consists of StemPro-34 serum-free medium (SFM) (Thermo Fisher Scientific) supplemented with GlutaMax (2\u2009mM, Thermo Fisher Scientific). In the third step (Day 6), the hematopoietic precursor cells were pushed towards myeloid differentiation with a different cocktail of factors [Fms-Like Tyrosine Kinase-3 ligand (FLT-3 ligand, 50\u2009ng\/mL, Gemini Bio), Interleukin-3 (IL-3, 50\u2009ng\/mL, Gemini Bio), Stem Cell Factor (SCF, 50\u2009ng\/mL, Gemini Bio), Thrombopoietin (TPO, 5\u2009ng\/mL, Peprotech), and Macrophage Colony-Stimulating Factor (M-CSF, 50\u2009ng\/mL, Gemini Bio)] in the MPDM for twelve days with media changes on days 6 and 10. In step four (Day 13), cells were fated into the monocytic lineage with supplementation of a cocktail of factors [FLT-3 ligand (50\u2009ng\/mL, Gemini Bio), M-CSF (50\u2009ng\/mL, Gemini Bio), and Granulocyte Macrophage Colony-Stimulating Factor (GM-CSF, 25\u2009ng\/mL, Peprotech)] in the MPDM with media changed twice a week. Cells produced in suspension in step 4 were recovered by centrifugation, resuspended in brain organoid media supplemented with M-CSF (50\u2009ng\/mL, Gemini Bio) and Interleukin-34 (IL-34, 50\u2009ng\/mL, BioLegend), replated and allowed to mature for one week prior to use in experiments.<\/p>\n Total RNA was obtained from microglia using the RNeasy Plus Micro Kit (QIAGEN, Hilden, Germany). RNA was then used to generate cDNA using the QuantiTect\u24c7<\/span><\/sup> Reverse Transcription Kit (QIAGEN, Hilden, Germany), and 10\u2009ng of cDNA was assayed in each 20\u2009\u00b5L qPCR reaction in triplicate using individual primers (Integrated DNA Technologies, Coralville, IA, USA) and iQ\u2122 SYBR\u24c7<\/span><\/sup> Green Supermix (Bio-Rad Laboratories, Hercules, CA, USA). Thermal cycling and plate readings were performed on a Bio-Rad CFX Connect\u2122 Real-Time System. Relative gene expressions were calculated using the \u0394\u0394CT<\/sub> method and GAPDH as a reference gene. For the detection of L1 ORFs, 10\u2009ng of microglia cDNA was assayed in 12\u2009\u00b5L qPCR reactions using TaqMan\u2122 probes and the TaqMan\u2122 Fast Advanced Master Mix (Life Technologies). The L1 probes were described previously [15<\/a>].<\/p>\n ORF1:<\/u>ATGGGGAAAAAACAGAACAGAAAAACTGGAAACTCTAAAACGCAGAGCGCCTCTCCTCCTCCAAAGGAACGCAGTTCCTC<\/p>\n ORF2:<\/u>GCTCATGGGTAGGAAGAATCAATATCGTGAAAATGGCCATACTGCCCAAGGTAATTTACAGATTCAATGCCATCCCCATC<\/p>\n ORF2-3\u2032UTR:<\/u>TGGAAACCATCATTCTCAGTAAACTATCGCAAGAACAAAAAACCAAACACCGCATATTCTCACTCATAGGTGGGAATTGA<\/p>\n List of Primers:<\/p>\nMycoplasma testing<\/h3>\n
Differentiation of PSCs to microglia<\/h3>\n
RT-qPCR analysis<\/h3>\n