Search
Close this search box.

Virus-like structures for combination antigen protein mRNA vaccination – Nature Nanotechnology

Ethics statement

Four- to five-week-old K18-hACE2 C57BL/6 mice (human ACE2 gene knock-in C57BL/6 mice) by Cyagen Biosciences (animal license number SCXK (Su) 2022-0016). BALB/c mice and seven- to eight-week-old golden hamsters were purchased from Vital River (animal license numbers SCXK (Jing) 2021-0006 and SCXK (Jing) 2021-0011). All animals were bred in specific pathogen-fee barrier facilities (laboratory license number SYXK (Lu) 2020-0019). The laboratory animals were cared for and used following the ‘3 Rs’ principle and animal welfare guidelines. The animal experiment process and animal-related care and welfare were reviewed and approved by the Animal Experiment Ethics Committee of Shandong WeigaoLitong Biological Products (approval number LACUC-RD3-2022-006).

Cell lines

HEK-293T and 16HBE cells were cultured in Dulbecco’s modified Eagle’s medium (DMEM, Thermo Fisher Scientific) supplemented with 10% fetal bovine serum (FBS; HyClone, GE Healthcare), 10% 100 U ml−1 penicillin and 100 mg ml−1 streptomycin. JASWII dendritic cells were cultured in MEM Alpha (Thermo Fisher Scientific) supplemented with 20% FBS and 5 ng ml−1 murine granulocyte–macrophage colony-stimulating factor (HY-P7361, MCE). RAW264.7 cells were cultured in minimum Eagle’s medium (MEM; Thermo Fisher Scientific) supplemented with 10% FBS. THP-1 cells were cultured in RPMI 1640 (Thermo Fisher Scientific) supplemented with 10% FBS and 0.05 mM β-mercaptoethanol (M917637, Macklin). All cells were purchased from ATCC and maintained at 37 °C with 5% CO2.

Virus

The novel coronavirus H strain (Omicron BA.5) was isolated from COVID-19 patients in December 2022. The complete genome sequence was uploaded to NCBI GenBank (OQ179919.1). The novel coronavirus KMS-2 strain (Wuhan) was isolated from COVID-19 patients at the Hospital for Infectious Diseases in Yunnan Province in February 2020.

Animal experimental design

C57BL/6-ACE2 (BALB/c or golden hamster) mice were randomly divided into five groups (Supplementary Fig. 7).

In group A (immune experimental group, n = 35), C57BL/6-hACE2 mice were divided into four groups: control, VLS, mRNA and peptide. The VLS contained 20 μg of mRNA and 10 μg of protein; the mice in the mRNA group were immunized with 20 μg of mRNA, and the mice in the peptide group were immunized with 10 μg of protein. All the mice underwent booster immunization on the 21st day after primary immunization. At 24, 48 and 72 h after primary immunization, tissues from the immune site were obtained for immunofluorescence detection for qRT–PCR measurement of cytokine expression. Moreover, B, CD4+ T and CD8+ T cells were sorted from lymph nodes at 3, 7 and 14 days after primary immunization and 28 days after booster immunization for transcriptome sequencing.

In group B (immune experimental group, n = 36), C57BL/6-hACE2 mice were divided into three groups: the control, VLS and mRNA groups. The mRNA used for the VLS and mRNA vaccines to explore the tissue site of mRNA molecules with the delivery system. The heart, liver, spleen, kidneys, lungs, brain and lymph nodes were collected at 1, 3, 5 and 7 days after i.m. injection for tissue immunofluorescence detection.

In group C (immune experimental group, n = 72), BALB/c mice were divided into 12 groups: N1–N12. N1–N4 were the mRNA vaccine groups, N5–N8 were the VLS vaccine groups and N9–N12 were the peptide vaccine groups. N1–N4 contained 5, 10, 20 and 40 μg mRNA, respectively. N5–N8 contained 5 μg mRNA and 5 μg peptide, 10 μg mRNA and 5 μg peptide, 10 μg mRNA and 10 μg peptide, and 20 μg mRNA and 10 μg peptide, respectively. N9–N12 contained 5 μg, 10 μg, 20 μg and 30 μg of peptide, respectively. All the mice underwent booster immunization on the 21st day after primary immunization. Blood samples were collected from the tail vein on days 35, 49, 120, 180 and 240 after immunization for antibody detection. At 28 days after booster immunization, blood was collected for neutralizing antibody and binding antibody testing, and the spleen was subjected to lymphocyte separation and ELISpot assays. At the same time, the immune titre of the SARS-CoV-2 vaccine was compared.

In group D (immunoprotective experimental group; C57BL/6-hACE2, n = 75; golden hamster, n = 40), at 28 days after booster immunization, the mice in the control, VLS, mRNA and peptide groups were challenged with SARS-CoV-2 Omicron BA.5 (104.5 50% cell culture infectious dose (CCID50)), SARS-CoV-2 wild-type (104 CCID50) or SARS-CoV-2 Omicron XBB.1 (104.5 CCID50) via the intranasal route. The heart, liver, spleen, kidneys, lungs, trachea, brain, spinal cord, lymph nodes and sex organs were collected at 3, 5 and 7 days after viral infection for viral load quantification. Meanwhile, B, CD4+ T and CD8+ T cells were sorted from C57BL/6-hACE2 mouse lymph nodes at 3 days after challenge for transcriptome sequencing.

In group E (transfusion experiment, n = 27), DCs were treated with LNPs-peptide, LNPs-mRNA and VLSs for 12 h. The in vitro-treated DCs (3 × 105 cells per mouse) were transfused into mice through the tail vein. The spleen and inguinal lymph nodes were obtained at 3 and 5 days after adoptive transfer for flow cytometry and qRT‒PCR. Antibody titres were measured 21 days after transfusion. The above animal challenge experiments were commissioned by Wuhan Institute of Biological Products.

Synthesis and formulation of the LNP delivery system

According to the molecular weights of ((2-(2-hydroxyethoxyl)ethyl)azanddiyl)bis(hexane-6,1-diyl)bis(2-hexyldecanoate), 1,2-dioleoyl-3-trimethylammonium propane, 1,2-dierucoyl-phosphatidylcholine and methoxypoly(ethylene glycol)-N-tetradecyltetradecanamide-1-2k, these were dissolved in absolute ethanol (Grade of guaranteed reagent) to molecular concentrations of 20%, 10%, 20% and 10%, respectively. All four components were mixed at a molar ratio of 30.68:6.84:15.2:1 in ethanol to prepare the LNP delivery system. The mRNA was diluted according to the requested ratio in buffer of 20 mM sodium acetate, 2.5 mM KCl and 0.1% trehalose. The LNP–mRNA was prepared with NanoAssemblr Ignite+ LNPs (Precision Nanosystems) by mixing blank LNPs with mRNA at a weight ratio of 1:3. The lipid particles were further characterized by Zetasizer Ultra spectrometry.

Synthesis of SARS-CoV-2 S1 mRNA

The S1 sequence of SARS-CoV-2 was amplified and inserted into the PVAX vector by PCR technology. The 5′-untranslated region (UTR) of yellow fever virus was amplified and inserted before the Kozak sequence and the 3′-UTR of the human mitochondrial ribosome was amplified and inserted after the S1 sequence as the 5′-UTR and 3′-UTR of the S1 sequence. The constructed plasmid was linearized with BamHI (catalogue number R0136V, NEB) at 37 °C for 3 h for the in vitro transcription reaction. N1mψ-modified S1 mRNA was synthesized through an in vitro transcription reaction (HiScribe T7 ARCA mRNA Kit, catalogue number E2060S, NEB). The reaction mixture was treated with DNase I and purified using lithium chloride precipitation.

Preparation of the VLS vaccine

The VLS vaccine was prepared by adding LNP–mRNA and peptide to the buffer (0.1% trehalose and 3.5% glucose) and mixing at room temperature for 30 min at 30 r.p.m. before rotating the mixture at 10 r.p.m. at 4 °C overnight. The VLS vaccine was further characterized by Zetasizer Ultra spectrometry.

LNP mRNA- and VLS-transfected cells

Then, 0.5, 1, 2, 5 and 10 μg of mRNA was transfected into 293T cells with the LNP delivery system, and western blot detection was performed at 24 h after transfection. Meanwhile, the mRNA and VLSs were transfected into 16HBE, JASWII DCs, THP-1 cells and RAW264.7 cells for Western blot analysis and qRT‒PCR measurement at 24 h.

Co-immunoprecipitation

Anti-S1 and anti-N antibodies were added to the LNP-encapsulated mRNA and VLS vaccine (the VLS vaccines were loaded with BA.1 S1 protein or N protein). Then, 50 μl of magnetic beads (BeaverBeads Protein A Matrix Antibody Purification Kit, catalogue number 20102, Suzhou) were added and incubated for 30 min at room temperature at 30 r.p.m. Next, the samples with magnetic beads were adsorbed at room temperature for 2–3 min at the magnetic pole, and the supernatant was used for mRNA and protein content measurement. Then, washing buffer was used to wash the beads, and elution buffer was added for elution and measurement of mRNA by qRT‒PCR and protein content by ELISA.

qRT–PCR

The amount of mRNA in the VLS and mRNA vaccines was measured by qRT‒PCR. Based on the guidelines, the binding site designed for the primer was located in the SARS-CoV-2 S1 gene region, and part of the S1 gene was constructed in the pUC57 plasmid. In vitro-transcribed mRNA was used as a standard sample. The primers were F: TGGATCTGGAGGGAAAGCAGGGCAACT and R: CCGATTGGCAGATCCACCAGAGGTTC, and the TaqMan probe (Sangon Biotech) had the sequence 5′-6FAM-ATGGCTACTTCAAGATCTATAGCAAGC-TAMRA-3′.

The viral loads in the tissues were determined by qPCR with absolute quantification. Based on World Health Organization guidelines, the binding site designed for the primer was located in the SARS-CoV-2 N gene region, and the N gene was constructed on the pUC57 plasmid. The primers were F: GAATGGCTGGCAATGGCGGTGATGCT and R: TTGTTGGCCTTTACCAGACATTTTGCT, and the TaqMan probe (Sangon Biotech) had the sequence 5′-6FAM-TTGCTGCTGCTTGACAGATT-TAMRA-3′. Viral genomic RNA was extracted from tissues using RNAiso Plus (T9108, Takara), and the reactions were performed using a One Step PrimeScript RT‒PCR Kit (Perfect Real Time) (TaKaRa, code RR064A).

For the relative expression of cytokines in tissues and cells, total RNA was extracted with RNAiso Plus (T9108, Takara). Gene expression was expressed as the fold change (2−∆∆Ct) relative to the levels in samples from LNP-injected mice or virus-uninfected cells, which were used for calibration. The reactions were performed by using a One-Step SYBR PrimeScript PLUS RT–PCR Kit (TakaRa, code RR096A). The specific primers used are listed in Extended Data Tables 4 and 5.

Immunofluorescence and confocal microscopy

Muscle tissues were collected and immediately frozen in liquid nitrogen. The tissue sections were embedded in OCT (Tissue-Tek OCT Compound 4583, Sakura) and sliced on a cryostat to a thickness of 5 µm (CM1850, Leica). Tissue sections were fixed and blocked with 5% BSA. For detection of the viral antigen, the sections were sequentially incubated with a primary mouse anti-SARS-CoV-2 S antibody (Sino Biological, catalogue number 40150-V08B1) and an Alexa Fluor 647-conjugated goat anti-mouse IgG secondary antibody (Invitrogen). DCs were detected using an anti-CD11c antibody (Abcam, catalogue number ab33483-N418), and macrophages were detected using an anti-F4/80 antibody (Zhengneng, catalogue number 263101-31B1), an Alexa Fluor 488-conjugated goat anti-rabbit IgG secondary antibody and a 647-conjugated goat anti-mouse IgG secondary antibody (Invitrogen). All cell nuclei were detected using 4,6-diamidino-2-phenylindole and analysed using a confocal microscope (TCS SP2, Leica).

Virus titration

The virus titre was determined with a plaque assay in accordance with standard protocols, as described previously28. In brief, the virus was subjected to gradient dilution and added to six-well plates. Carboxymethylcellulose was used as the matrix in a liquid overlay, crystal violet was used as the stain to enhance plaque visualization, and the cells were cultured at 37 °C with 5% CO2 for 7 days.

Neutralization assay

Briefly, serum was inactivated for 30 min at 56 °C, continuously diluted from 1:4 and mixed with virus at a titre of 100 times the CCID50/100 μl and incubated at 37 °C for 2 h. The mixture was added to a six-well plate and used carboxymethylcelluloseas the matrix, and crystal violet was used as the stain to enhance plaque visualization after culture at 37 °C with 5% CO2. Meanwhile, the serum neutralization titres of pseudoviruses were measured, and the 50% inhibitory dilution (EC50) was defined as the serum dilution at which the relative light units were reduced by 50% compared with those of the virus control wells (virus + cells) after subtraction of the background relative light units in the control groups with cells only. In brief, pseudovirus (Acro, catalogue number PSSO-HLC016) was incubated with serial dilutions of the test samples continuously diluted from 1:64 in duplicate for 1 h at 37 °C, together with the virus control and cell control wells. Then, 293T-ACE2 cells were added to each well. Following 48 h of incubation in a 5% CO2 environment at 37 °C, the luminescence was measured.

IFNγ-specific and IL-4-specific ELISpot assay

For the ELISpot assay, mouse IFNγ and IL-4 ELISpot kits (Mabtech) were used according to the manufacturer’s protocol. Briefly, a plate was conditioned and seeded with splenic lymphocytes prior to the addition of 3 μg of stimulant (XBB Spike RBD Protein, catalogue number 40592-V08H144, Sino Biological; B.1.1.529 Spike RBD Protein, catalogue number SPD-C522e, Acro; BA.4/BA.5 Spike RBD Protein, catalogue number SPD-C522R, Acro; BA.2.12.1 Spike RBD Protein, catalogue number SPD-C522q, Acro; BQ.1.1 Spike RBD Protein, catalogue number SPD-C5240, Acro; BA.2.75.2 Spike RBD Protein, catalogue number SPD-C522z, Acro). Then, the cells were added and incubated at 37 °C for 30 h. Next, the cells and medium were removed, and the plate was developed. The coloured spots were counted using an ELISpot reader (Mabtech).

Isolation of B, CD4+ T and CD8a+ T cells from mouse lymph nodes

Lymph nodes were isolated under sterile conditions and gently ground, and lymphocytes were separated into a suspension.

B cells were enriched with MajoSort Mouse CD19 Nanobeads (catalogue number SPD-C522R, Acro 480002, BioLegend), CD4+ T cells were enriched with the EasySep Mouse CD4+ T-cell isolation kit (catalogue number SPD-C522R, Acro 19852A, Stemcell), and CD8+ T cells were enriched with the EasySep Mouse CD8a+ selection kit (catalogue number SPD-C522R, Acro 18953, Stemcell).

Transcriptome analysis of B, CD4+ T and CD8a+ T cells

The B, CD4+ T and CD8a+ T cells were sorted by lymph nodes. Total RNA was extracted using TRIzol (catalogue number DP421, Tiangen). RNA quantity and integrity were evaluated using a NanoDrop system and a Bioanalyzer, and the samples were prepared according to Illumina’s instructions and sequenced (Gene Denovo Biotechnology). Genes with 2-fold or greater changes in expression at P < 0.05 in the Kyoto Encyclopedia of Genes and Genomes analyses were selected and grouped into functional categories. All transcriptome sequencing results were uploaded to GSA; the assigned accession number of the submission was CRA010542.

ELISA

The S1 antigen was quantified using a SARS-CoV-2 Spike Protein ELISA Kit (Acro, catalogue number RAS-A039), and the nucleoprotein was quantified using a SARS-CoV-2 (2019-nCoV) Nucleoprotein ELISA Kit (Jiya Biotechnology,). S1-RBD IgG assays were performed using SARS-CoV-2 RBD (Wild-Type) Antibody (IgG) Detection Kits (Vazyme, catalogue number DD3201-01), SARS-CoV-2 RBD (Omicron BA.4/5) Antibody (IgG) Detection Kits (Vazyme, catalogue number DD3214-01, China) and Mouse Anti-2019-nCoV (S) IgA Elisa Kits (FineTest, catalogue number 1906).

The S1 antibody assays were performed using a Mouse Anti-SARS-CoV-2 (B.1.1.529) Antibody IgG Titer Serologic Assay Kit (Spike S1) (Acro, catalogue number RAS-T061), Mouse Anti-SARS-CoV-2 Antibody IgG Titer Serologic Assay Kit (Spike S1) (Acro, catalogue number RAS-T045), Mouse Anti-SARS-CoV-2 (B.1.351) Antibody IgG Titer Serologic Assay Kit (Spike S1) (Acro, catalogue number RAS-T084), Mouse Anti-SARS-CoV-2 (B.1.617.2) Antibody IgG Titer Serologic Assay Kit (Spike S1) (Acro, catalogue number RAS-T086). The antibody serum samples that yielded optical density values at least 2.1-fold higher than that of the negative control were considered positive. The endpoint titre was defined as the highest serum dilution that yielded a positive optical density value. The geometric mean titre was calculated as the geometric mean of the endpoint titres of the positive serum samples in each group.

Western blotting

Proteins were separated by 12% SDS–PAGE and transferred to polyvinylidene difluoride membranes. The membranes were blocked with 5% bovine serum albumin–Tris-buffered saline with Tween-20 (Sigma-Aldrich) and incubated with an anti-SARS-CoV-2 S1 antibody (MHC0102, Yunnan Lepeng Technology), anti-ACE2 antibody (Abcam, catalogue number ab15348), and anti-DC-SIGN antibody (Santa Cruz Biotechnology, catalogue number sc-74589) for 2 h; washed three times and incubated with HRP-conjugated goat anti-mouse IgG (H + L) (Sigma) for 1 h. Finally, the polyvinylidene difluoride membranes were washed three times and covered with ECL ultrasensitive chemiluminescence reagent (NCM Biotech, catalogue number P10100) and placed in a Bio-Rad gel imager for exposure and colour development.

Silver staining with SDS‒PAGE

The prepared SDS–PAGE gel was silver-stained with a kit (Fast Silver Stain Kit, catalogue number P0017S, Beyotime). Silver staining of the SDS‒PAGE gels was performed in ten steps: fixation, washing with 30% ethanol, washing with water, sensitization, washing with water, silver staining, washing with water, colour development, termination and washing with water.

Flow cytometry analysis

Lymph nodes and spleens were collected on days 3 and 7 after primary and booster immunization with the vaccine, and isolated lymphocyte. The flow-labelled antibodies used to detect the surface markers of DC activation were PE/Cy5-CD45 (catalogue number MA5-38732, Thermo Fisher), PE/Cy7-CD11c (catalogue number A15849, Thermo Fisher), FITC-CD80 (catalogue number A14722, Thermo Fisher), APC-CD83 (catalogue number ab234119, Abcam), and PE-CD86 (catalogue number 12-0862-82, Thermo Fisher). The flow-labelled antibodies used to detect specific T-cell surface markers were BV421-CD44 (catalogue number 103019, BioLegend), APC-CD25 (catalogue number 102011, BioLegend), PE/Cy5-CD3 (catalogue number 100205, BioLegend), FITC-CD4 (catalogue number 100405, BioLegend), APC/Cy7-CD8 (catalogue number 100713, BioLegend) and PE-Tetramer (Helixgen COVID-19 MHC-I Tetramer). The flow-labelled antibodies used to detect activated B-cell surface markers were FITC-CD19 (catalogue number 115505, BioLegend), PerCp/Cy5.5-GL7 (catalogue number 144609, BioLegend) and PE-S1 (Expedeon, catalogue number 336-005). The cells were stained for 30 min at 4 °C and washed twice prior to flow cytometric analysis (LSR Fortessa, BD).

Luminex assays

The Bio-Plex Mouse 23-Plex Panel assay (catalogue number M60009RDPD) was performed according to the manufacturer’s instructions. Briefly, a standard curve ranging from 1.6 to 10,000 pg ml−1 was generated by serial dilution of the reconstituted standard. The filter plates were blocked by pipetting 200 µl of assay buffer into each well. After 10 min, the assay buffer was discarded by vacuum aspiration, and 25 µl of assay diluent was added to the wells designated for the samples, RPMI 1640 with GlutaMAX (Gibco) was added to the wells for the standards. Then, standard or sample was added to the appropriate wells, and 25 µl of antibody-coated fluorescent beads was added. Biotinylated secondary and streptavidin–phycoerythrin-labelled antibodies were subsequently added to the plate through alternating incubation and washing steps. Then, 100 µl of sheath fluid was added to the wells, and read immediately with the Bio-Plex array reader at high and low RP1 targets using a five-parameter logistic regression curve.

Statistical analysis and reproducibility

For western blot and electron microscopy, immunofluorescence assays were repeated at least twice; for ELISA, quantitative analysis was repeated at least three times. All the data are expressed as mean values with s.e.m. Significant differences between groups were analysed by GraphPad Prism. Statistical significance was set to P < 0.05.

Reporting summary

Further information on research design is available in the Nature Portfolio Reporting Summary linked to this article.