Search
Close this search box.

Umbilical cord mesenchymal stem cell-derived exosomes inhibits fibrosis in human endometrial stromal cells via miR-140-3p/FOXP1/Smad axis – Scientific Reports

Preparation of human UCMSCs (hUCMSCs)

Fresh umbilical cords were from the mothers who just gave birth, and informed consent was obtained from hospitalized mothers at General Hospital of Ningxia Medical University, and rapidly processed. The Ethics Committee of General Hospital of Ningxia Medical University approved this study (Ethical code: 2020-125). All experiments were performed in accordance with relevant guidelines and regulations. Repeatedly rinsed the cord several times with PBS and removed the blood vessels and the outer membrane of the umbilical cord. Then, the cords were cut into small pieces and were cultured in Nuwacell ncMission hMSC Medium (Nuwacell, China) supplemented with 1 × GlutaMAX™ and 50 μg/ml gentamycin (Thermofisher scientific, Carlsbad, CA, USA). All cultures were maintained at 37 °C in a humidified incubator with 5% CO2. The medium was changed every 3 days and the cells were passaged after detachment with Recombinant Trypsin EDTA Solution (Biological Industries, Israel). All experiments used the less than 5th passages hUCMSCs.

Flow cytometry analysis

Surface phenotype analysis of hUCMSCs was evaluated by flow cytometry. Briefly, hUCMSCs were detached and incubated with fluorescein-labeled antibodies for 30 min at 4 ℃. The tested antibodies included CD73, CD90, CD105, CD14, CD34, CD45, and HLA-DR (BD Biosciences, USA). Following extensive washing, the cells of each group were resuspended in 400 μL of PBS and detected by flow cytometry (BD Biosciences).

Multilineage differentiation assay in vitro

To evaluate adipogenic and osteogenic differentiation potential, hUCMSCs were incubated with adipogenic and osteogenic differentiation medium (BI Biological Industries, Israel) for 21 days and the medium was changed every 3 days. Adipogenic and osteogenesis were identified by adipogenic and osteogenic staining kit (BI Biological Industries, Israel) respectively. To assess cartilage differentiation potential, a cell solution of 1.6 × 107 hUCMSCs /mL to form a pellet by gravity. The pellet cells were cultured with cartilage differentiation medium (BI Biological Industries, Israel) for 21 days and the medium was changed twice a week. Chondrocytes were detected by a cartilage staining kit (BI Biological Industries, Israel). All the measurements were tested three times. All images were viewed under a bright field of view using an inverted phase contrast microscope (Olympus, Japan).

Cell culture

Human endometrial stromal cell (HESC) line was purchased from the American Type Culture Collection (ATCC CRL-4003) and was cultured in DMEM/F12 medium supplemented with 10% charcoal-stripped fetal calf serum and antibiotics (BI Biological Industries, Israel). All cells were cultured at 37 °C in a 5% CO2 humidified incubator. At about 80% confluence, the cells were passaged after detachment with Recombinant Trypsin EDTA Solution.

Isolation and identification of UCMSC-exo

Exosomes were extracted from the cell culture medium of UCMSCs using a VEX exosome isolation reagent (Vazyme, Nanjing, China) as previously described24. Briefly, the culture supernatant was centrifuged at 4 °C 3000g for 30 min to remove cells and passed through a 0.22 μm filter (Millipore, USA) to eliminate cell debris and dead cells. Subsequently, the VEX Exosome Isolation Reagent was added into the supernatant and the mixture was vortexed and incubated at 4 °C for up to 16 h. Then, the mixture was centrifuged at 10,000g 4 °C for 30 min to precipitate exosome pellets. Finally, the pelleted exosomes were resuspended in PBS and stored at − 80 °C.

The total protein concentration of exosomes was detected using a bicinchoninic acid (BCA) protein assay kit (Beyotime, Shanghai, China). The expression levels of exosome-specific biomarkers CD9 (ab236630, Abcam, Cambridge, USA) and TSG101 (ab133586, Abcam) were analyzed by western blot. Nanoparticle tracking analysis (NTA) with ZetaView® (Particle Metrix, Germany) was emplpyed to quantify the size of exosomes. The exosome morphology was captured by a transmission electron microscopy (TEM, HT-7700, Hitachi, Japan). To detect the internalization of exosomes in HESCs, the purified exosomes were labeled with a red fluorescence dye PKH26 (SigmaAldrich, St. Louis, USA) according to the manufacturer’s instructions. HESCs and PKH26 labeled-exosomes were co-cultured for 24 h and fixed with 4% paraformaldehyde. After the nuclear was counterstained with DAPI, the images were observed by Olympus FSX100 microscope (Olympus, Japan).

Treatment and cell transfection

Based on existing research14,25, using 50 ng/ml TGF-β dealing with HESC to induce fibrosis. It has been suggested that 20 µg/ml of UCMSC-exo could significantly enhance the viability of HESCs26. Thus, the dose of 20 µg/ml was selected in this study to determine the anti-fibrotic properties of UCMSC-exo.

Expression vectors encoding FOXP1 were constructed and inserted into the pcDNA3.1 vector (oeFOXP1), while the empty pcDNA3.1 vectors were used as negative control (oeNC). The GenePharma Company (Shanghai, China) was responsible for the creation of the two vectors. MiR-140-3p inhibitor (anti-miR-140-3p), miR-140-3p mimic and their corresponding negative controls were constructed by Guangzhou RiboBio Co., Ltd. Using Lipofectamine 3000 reagent (Invitrogen), oeFOXP1 and oeNC were transfected in HESCs to overexpress FOXP1, anti-miR-140-3p, miR-140-3p mimics and their controls were transfected in UCMSCs.

Dual luciferase reporter assay

To verify whether miR-140-3p was targeted at FOXP1, luciferase reporter assay was performed. Clone the FOXP1 sequence, including wild type (WT) (GGCTTTGGTCAGCATTTTTCATTTAAAGAAAAGTAACACTCCCATCCACTCATAAGCTTGGTACAAAAACTTCTCTGGCAGTTACTTTTGAAGCTTCACTCTGCTTTCTGTATAAAGGGCAGTCTGTGGTCACGCAAGACTTTAAAAAAA) and mutant type (MUT) (GGCTTTGGTCAGCATTTTTCATTTAAAGAAAAGTAACACTCCCATCCACTCATAAGCTTGGTACAAAAACTTCTCTGGCAGTTACTTTTGAAGCTTCACTCTGCTTTCTGTATAAAGGGCAGTTCACAACCACGCAAGACTTTAAAAAAA) of miR-140-3p binding sites (3’UTR), downstream of the firefly luciferase gene in the pGL3 luciferase reporter vectors. Using the Lipofectamine 3000 reagent (Invitrogen), co-transfect the FOXP1 wild type vector (FOXP1-3’UTR-WT) and mutant type vector (FOXP1-3’UTR-MUT) into HESCs with miR-140-3p mimic or mimic NC. After transfection of 48 h, the luciferase activity was measured using the Dual-Glo Luciferase Assay System.

qRT-PCR

Total RNA was extracted from exosomes and cells using the TRIzol reagent (Invitrogen) and reversely transcribed into cDNA by cDNA Synthesis Kit (TaKaRa Bio, USA). An ABI StepOnePlus™ System (Applied Biosystems, USA) was utilized to perform qRT-PCR. The relative expression of miRNA and mRNA were normalized to U6 and β-act, in respectively. The following primers were presented:miR-140-3p,forward 5’-CAGTGCTGTACCACAGGGTAGA-3’ and reverse 5’-TATCCTTGTTCACGACTCCTTCAC-3’;FOXP1,forward 5’-ATGGAGCATACCAACAGCAACG-3’ and reverse 5’-ACTGTGGTTGGCTGTTGTCAC-3’. The data were calculated using the 2Ct method.

Western blotting

The proteins extracted from cells were separated and transferred onto PVDF membranes (Millipore, USA). After blocking with 5% skimmed milk, the membranes were incubated with antibodies CD9 (1:1000, ab236630, Abcam), TSG101 (1:1000, ab133586, Abcam), α-smooth muscle actin [α-SMA, 1:1000, #19245, Cell Signaling Technology (CST), Danvers, USA], collagen type I α1 chain (COL1A1, 1:1000, #72026, CST), connective tissue growth factor (CTGF, 1:1000, #86641, CST), FOXP1 (1:1000, #4402, CST), phosphor(p)-Smad2 (1:1000, #18338, CST), p-Smad3 (1:1000, #9520, CST), SMAD2/3 (1:1000, #8685, CST), and SMAD interacting protein 1 (SIP1, 1:1000, #97885, CST). After that, the membranes were incubated with HRP-linked secondary antibody. ECL (Millipore) solution was used to observe the protein band. Relative protein expression was quantified by BioImaging Systems.

Statistical analysis

All data were analyzed by SPSS 22.0. The measurement data were described as mean ± Standard Deviation (SD). The differences among groups were evaluated by a Student’s t test (for 2 groups) or ANOVA (for more than 2 groups) followed by a LSD post hoc test. P < 0.05 was considered statistically significant.

Ethical approval

The study was approved by the Medical Ethics Committee of General Hospital of Ningxia Medical University (No. 2020-125).

Consent to participate

All authors agree to participate in this project and research.

Latest Intelligence