SPOCK2 controls the proliferation and function of immature pancreatic β-cells through MMP2

EndoC-βH1 cell culture

The EndoC-βH1 cell line generated from the human fetal pancreas by Dr. Philippe Ravassard³⁴ was obtained from the distributor Univercell-Biosolutions. The cells were cultured in Dulbecco’s modified Eagle’s medium containing 1 g/L glucose (DMEM; Corning) supplemented with 2% BSA fraction V fatty acid-free (Millipore), 50 μM 2-mercaptoethanol (Thermo Fisher Scientific), 10 mM nicotinamide (Sigma Aldrich), 5.5 μg/mL transferrin (Sigma Aldrich), 6.7 ng/mL selenite (Sigma Aldrich), 100 μ/mL penicillin, and 100 μg/mL streptomycin on Geltrex (200 μg/mL)- and fibronectin (4 μg/mL; Sigma Aldrich)-coated cell culture plates. The cells were tested for mycoplasma infection every two weeks. The plates were seeded at a density of 8 × 10⁵ cells/cm², and the cells were passaged every 7 days with trypsin (GIBCO). The medium was changed every 2–3 days. The cells were cultured at 37 °C in an atmosphere containing 5% CO₂.

hPSC culture and differentiation into β-cells

H1, HUES8 or HUES3 hPSCs were cultured in StemFlex (Thermo Fisher Scientific) medium on vitronectin (rh VTN; Thermo Fisher Scientific)-coated plates at 37 °C in an atmosphere containing 5% CO₂. The cells were passaged every 3‒4 days (~80% confluency) with PBS-EDTA. The cells were tested for mycoplasma monthly via a PCR assay. Prior to differentiation, the cells were dispersed into single-cell suspensions with TrypLE Select (Thermo Fisher Scientific) and plated at a density of 1.5 × 10⁵ cells/cm² in StemFlex supplemented with 10 µM Y-27632 (Peprotech) on Geltrex (Thermo Fisher Scientific)-coated plates. On subsequent days, the cells were washed in PBS, and the medium was changed as follows³⁵.

Day 1: RPMI (Corning, USA) + 1× GlutaMAX (Thermo Fisher Scientific) + 1× pen/strep (Thermo Fisher Scientific) + 3 µM CHIR99021 (Peprotech) + 100 ng/mL activin A (Peprotech)

Days 2–3: RPMI + 1× GlutaMAX + 1× pen/strep+ 0.2% FBS HyClone (GE Healthcare) + Activin A

Days 4–5: RPMI + 2% FBS + 1 × GlutaMAX + 1 × pen/strep + 50 ng/mL KGF (Peprotech)

Days 6–9: DMEM (Corning) + GlutaMAX + 1× pen/strep + 1% B27 (Thermo Fisher Scientific) + 50 ng/mL KGF + 2 µM all-trans retinoic acid (Peprotech) + 100 nM LDN193189 (Peprotech) + 250 nM SANT-1 (Biotechne)

Days 10–14: DMEM (Corning) + 1× GlutaMAX + 1× pen/strep + 1% B27 (Thermo Fisher Scientific) + 100 nM LDN193189 + 250 nM SANT-1 + 1 µM phorbol 12,13-dibutyrate (Biotechne) + 1 µM Alk5i II (Adooq Bioscience)

Days 15–31: CMRL 1066 (Corning) + 1× GlutaMAX + 1 × pen/strep + 10% FBS + 10 µM Alk5i II + 1 µM T3 hormone (Sigma Aldrich).

The medium was changed daily on Days 1–19 and every other day from Day 20 onward.

Treatment of β-cells with growth factors or small molecules

EndoC-βH1 or SC-β-cells were seeded on plates at a density of 8 × 10⁵ cells/cm² and cultured for 2‒3 days before treatment for 2‒7 days with 10 µM CHIR99021 (Peprotech), an MMP2 inhibitor (MMP2i) (Cayman Chemicals) at concentrations of 0.5 µM, 2 µM, and 5 µM; rh SPOCK2 (R&D Systems) at concentrations of 0.5 µg/mL, 1 µg/mL, and 2 µg/mL; rh MMP2 (R&D Systems) at concentrations of 5 ng/mL, 15 ng/mL, 30 ng/mL and 140 ng/mL; harmine (R&D Systems) at a concentration of 10 μM; GW788388 (R&D Systems) at a concentration of 2 μM; WS6 (R&D Systems) at a concentration of 1 μM; or the JNK inhibitor SP600125 (Tocris) at concentrations of 20 μM or 40 μM.

Human islet isolation

Human pancreata were obtained with informed consent for transplant or research use from relatives of heart-beating, cadaveric multiorgan donors through the efforts of The National Disease Research Interchange (NDRI), Tennessee Donor Services, the Mid-South Transplant Foundation, and the United Network for Organ Sharing. Human islets were isolated under Human Islet Isolation for Research (HIIR) ethical approval number Pro00001097 to Drs. Omaima Sabek and Daniel Fraga (Houston Methodist Research Institute). Donor demographics were collected at the time of acceptance and included age (in years), sex, race, body mass index, history of alcohol intake, and history of hypertension. Donor-related laboratory data, including donor blood glucose, serum amylase, lipase, liver function tests (ALT, AST), cytomegalovirus infection status, and procurement and preservation parameters, such as pancreatic warm and cold ischemia times, ventilation time, pancreas weight and adequacy of pancreas perfusion, were also recorded. The pancreas was perfused with University of Wisconsin (UW) solution. Human islets were isolated from cadaver donors via an adaptation of the automated method described by Ricordi et al.³⁶. Liberase was dissolved in cold (4 °C) Hank’s balanced salt solution (HBSS) (Mediatech, Inc., Herndon, VA) supplemented with 0.2 mg/ml DNase (Sigma Chemical Co., St. Louis, MO), 1% penicillin‒streptomycin (Sigma Chemical Co.), 20 mg/dl calcium chloride (J.T. Baker, Inc., Phillipsburg, NJ), and HEPES (Sigma Chemical Co.). After dissolution, the pH was adjusted to between 7.7 and 7.9. The enzyme preparation was then sterile filtered, warmed to 37 °C, and used for intraductal distension of the pancreas. The distended pancreas was cut into several pieces and placed in a Ricordi chamber, and the heating circuit was started. Pancreatic digestion was performed at 37 °C until more than 90% free islets were observed in the sample. The digested tissue was collected in cold HBSS supplemented with 20% human serum and 1% penicillin‒streptomycin solution and centrifuged at 400 × g at 4 °C for 5 min. The tissue pellets were pooled into cold UW solution and held at 4 °C for 1 h with periodic mixing. Islet purification was performed on a COBE 2991 Cell Processor (COBE BCT, Lakewood, CO) using OptiPrep (Nycomed Pharma AS, Oslo, Norway) as a step gradient based on a modification of the procedure of Robertson et al.³⁷. Islet culture: Aliquots from human islet isolations were cultured in SFM containing 1% ITS (Collaborative Biomedical Products, Bedford, MA), 1% L-glutamine (Life Technologies, Gaithersburg, MD), 1% antibiotic-antimycotic solution (Sigma Chemical Co.), and 16.8 µM zinc sulfate, as described previously³⁸. Human islets were isolated from 5 nondiabetic donors: 49-year-old (BMI 25.3, A1c 4.9%), 52-year-old (BMI 37.5, A1c 5.3%), 63-year-old (BMI 32.5, A1c 4.8%) and 69-year-old (BMI 33.3, A1c 5.5%) males and 68-year-old (BMI 28.4, A1c 4.6%) and 70-year-old (BMI 26.1, A1c 4.8%) females.

Mouse islet isolation

Mouse islet isolation was performed via common bile duct perfusion with ice-cold 0.8 mM collagenase P (Roche), dissection, additional gentle dissociation with collagenase P and further purification in Histopaque gradient (Sigma) as described previously³⁹. For each islet prep, 10 adult (6–12-month-old) ICR males and females were used.

Glucose-stimulated Insulin secretion

Human primary, islet, SC-β-cells or EndoC-βH1 cells were incubated for 1 h in Krebs buffer (128 mM NaCl, 5 mM KCl, 2.7 mM CaCl₂, 1.2 mM MgCl₂, 1 mM Na₂HPO₄, 1.2 mM KH₂PO₄, 5 mM NaHCO₃, 10 mM HEPES, 0.1% BSA) and then incubated for 30 min in low-glucose (2.8 mM D-(+)-glucose) or high-glucose (16.7 mM D-(+)-glucose) Krebs buffer for each step. After each incubation step, the supernatants were collected. The cells were then dissociated via TrypLE Express and quantified (Countess, Invitrogen), and human insulin was measured via ELISA (Mercodia) according to the manufacturer’s instructions.

Reverse transcription‒quantitative PCR (RT‒qPCR)

Total RNA was extracted via TRIzol reagent (Thermo Fisher Scientific) according to the manufacturer’s instructions. For cDNA synthesis, 500 ng of RNA was reverse transcribed with the SuperScript II Reverse Transcriptase cDNA Synthesis Kit (Thermo Fisher Scientific) along with random hexamer primers. The cDNA was PCR amplified with Power SYBR Green qPCR Master Mix (Thermo Fisher Scientific). To quantify the gene expression levels, the amount of target gene in each sample was normalized against that of β-ACT via the ΔCT quantification method⁴⁰. The primer sequences are listed in Table 1.

Immunofluorescence staining

Human pancreas sections were processed at Baylor College of Medicine, Houston, TX (USA), under the IRB-3097 approval granted to Malgorzata Borowiak. The donor identities were encrypted, and the data were analyzed anonymously. Human 10.6- and 13-week fetal pancreas samples were fixed in 4% paraformaldehyde/phosphate-buffered saline (PBS) for 4 h, washed with PBS, soaked in 30% sucrose, and embedded in TissueTek. Section (12 μm thick) were cut onto Superfrost Plus-coated glass slides and stored at –80 °C.

EndoC-βH1 cells, SC-β-cells, and human or mouse primary islets were fixed by incubation with 4% paraformaldehyde/PBS for 15 min at room temperature and subjected to three short washes in PBS. Fixed cells and tissue samples were permeabilized via incubation with 0.5% Triton X-100 (BioShop) in PBS for 15 min and blocked via incubation with 3% BSA (Sigma Aldrich) or 0.1% Tween-20 (BioShop) in PBS for 30 min at room temperature or with 3% normal donkey serum (Jackson ImmunoResearch) or 0.1% Triton X-100 in PBS (NDS). The samples were then incubated overnight at 4 °C with primary antibodies diluted in 5% NDS. The primary antibodies used in the study are listed in Table 2. After two 10-min washes with 0.1% Tween 20 in PBS, the cells were incubated with secondary antibodies conjugated with Alexa Fluor 488, TRITC or Alexa Fluor 647 (all from Jackson ImmunoResearch) diluted 1:800 in 5% NDS for 2 h at room temperature. The excess secondary antibody was removed by two washes for 5 min each with PBS-Tween, and the samples were then incubated with DAPI (Sigma Aldrich) as a counterstain. The tissue samples were mounted in ProLong Diamond Antifade (Thermo Fisher Scientific) before imaging.

Imaging

Images were obtained with an epifluorescence or confocal microscope. Epifluorescence microscopy was performed with a Leica DM IL-Led (Leica, Germany) microscope with N Plan Fluor 4x/0.12, N Plan Fluor 10x/0.30, N Plan Fluor 20x/0.40 and N Plan Fluor 40x/0.60 lenses and a JENOPTIK Progres Gryphax camera (JENOPTIK, Germany). Confocal microscopy was performed with a Nikon A1Rsi (Nikon, Germany) microscope with Plan Fluor 4x/0.13, Plan Apo 10x/0.45 DIC N1, Plan Apo VC 20x/0.75 DIC N2, Apo 40x/1.25 WI λS DIC N2, and Plan Apo VC 60x/1.4 Oil DIC N2 lenses and with Nikon NIS Elements AR 5.21.01 64-bit software (Nikon, Germany). Mean gray value normalization was achieved by dividing the mean fluorescence signal of the protein target of interest by the mean fluorescence signal of DAPI.

Western blot

Protein extracts were prepared from EndoC-βH1 cells in radioimmunoprecipitation assay (RIPA) buffer (50 mM Tris-HCl, pH = 8.0 (Bio-Shop), 150 mM NaCl (Bio-Shop), 1% Nonidet-40 (Bio-Shop), 0.5% sodium deoxycholate (Bio-Shop), 0.1% SDS (Bio-Shop), 1% protease inhibitor cocktail (Sigma Aldrich), 1% EDTA (Sigma Aldrich), and 0.1% PMSF (Sigma Aldrich)) and stored at −80 °C. Protein concentrations were determined with a bicinchoninic acid (BCA) kit (Pierce). Thirty micrograms of protein in Bolt LDS buffer (Thermo Fisher Scientific) were heated at 70 °C for 10 min and then loaded onto a 4–12% Bis-Tris Plus gel (Thermo Fisher Scientific). Electrophoresis was performed at 165 V for the first 10 min and then at 200 V for 30 min, with a constant current of 100 amps. The resulting bands were transferred onto PVDF (Thermo Fisher Scientific) membranes for 10 min, and the membranes were then blocked with 0.125% nonfat dry milk or 1% BSA in TBS-Tween 20 and incubated with primary antibodies against SPOCK2, c-JUN, phospho-c-JUN, α-TUBULIN or GAPDH (Table 3). HRP-conjugated secondary antibodies—anti-rabbit (Sigma Aldrich, A9169) 1:20,000 or anti-mouse (Sigma Aldrich, A9044) 1:20,000—were used as appropriate. Antibody‒antigen complexes were visualized by enhanced chemiluminescence (ECL) with the Luminata Forte HRP Substrate (Merck Millipore) and detected with the G:Box System (Syngene). The western blot data were quantified via ImageJ with the “ analyze gel” function.

Zymography

For gelatin zymography, 10% SDS‒PAGE gels were impregnated with 4 mg/ml soluble gelatin type A substrate. The cell supernatants were collected and concentrated after 24 h of culture, prepared with a nonreducing loading dye (0.01% bromophenol blue, 10% SDS, 125 mM Tris-HCl, 20% glycerol) and separated via electrophoresis at 150 V for 1 h at 4 °C. The gels were washed in renaturing buffer and incubated in assay buffer overnight. Renaturing buffer contained 50 mM Tris-HCl buffer at pH 7.4 and 2.5% Triton X-100 with 5 mM CaCl₂ and 1 μM ZnCl₂. The assay buffer contained 50 mM Tris-HCl and 1% Triton X-100 with 5 mM CaCl₂ and 1 μM ZnCl₂. The gels were stained for 2 h in 0.5% Coomassie blue stain with 10% acetic acid and 40% methanol, destained with 10% acetic acid and 40% methanol, and imaged. Densitometric quantification of white band intensity (indicating protease activity) was performed via ImageJ.

Cell counting

For the proliferation assay, cell quantification was performed with ImageJ software (https://imagej.nih.gov/ij/). The bioimages were subjected to binarization, and an optimal signal threshold and watershed function were applied such that the cells in the image were distinguishable objects. The cells were then counted with the “Analyze particles” function for the blue (corresponding to DAPI⁺ cells) and red (corresponding to pHH3⁺ or Ki67⁺ cells) channels separately. For validation of the results, quantification was performed via the Manders colocalization method⁴¹ with the ImageJ “Just Another Colocalization” plugin (JACoP)⁴² (https://imagej.nih.gov/ij/plugins/track/jacop.html).

RNA sequencing

We used 1000 ng of total RNA isolated from EndoC-βH1 WT, SPOCK2 KD, SPOCK2 OE and GIPZ cells to prepare libraries with the TruSeq RNA Library Prep Kit v2 according to the manufacturer’s protocol. Libraries were prepared in duplicate. Libraries were quantified with a Qubit fluorometer (TFS), and their quality was assessed with an Agilent High Sensitivity DNA Kit (Agilent Technologies). Libraries were sequenced with an Illumina HiScanSQ sequencer. RNA-Seq raw paired-end reads were trimmed with fastp⁴³. The trimmed reads were aligned with the Ensembl GRCh38 human genome with STAR (v2.7)^44, and counts were obtained with featureCounts v1.6.3⁴⁵. The raw RNA-seq sequence reads were analyzed via the iDEP9.4 (integrated differential expression and pathway analysis) interactive platform (http://bioinformatics.sdstate.edu/idep93/)⁴⁶. Genes differentially expressed between EndoC-βH1 SPOCK2-KD and GIPZ cells or between SPOCK2-OE and WT cells were identified and normalized with the DESeq2 package⁴⁷. The RNA-seq data were deposited in the NCBI GEO database under accession number GSE190361. Differentially expressed genes (DEGs) significantly (p-value ≤ 0.05) upregulated with a log2FC ≥ 0.5 or downregulated with a log2FC ≤ –0.5 in any of the sequenced samples were selected for further analysis. Cluster analysis was performed with Genesis software (http://genome.tugraz.at/genesisclient/genesisclient_description.shtml)⁴⁸. The average linkage method was used for hierarchical clustering. The induction ratios of genes were log₂-transformed and subjected to clustering analysis. The automatic gene cluster assignment method was used to create gene clusters. Volcano plots were plotted with GraphPad Prism 8 software for genes with normalized reads, with –log₁₀ adjp values on the y-axis and log₂FC values on the x-axis. Genes with –log10 adjp ≥ 2 and log2FC ≥ 0.5 or log2FC ≤ –0.5 were considered to be significantly differentially expressed. Enrichment in Gene Ontology (GO) categories was assessed with Gorilla software (http://cbl-gorilla.cs.technion.ac.il/)⁴⁹. A p-value of 10^–3 was used as a threshold, and Illumina gene lists from HumanHT-12 v4 were used as the background model. All statistically significant and enriched GO categories were analyzed with Revigo software (http://revigo.irb.hr/)⁵⁰. Only GO terms with p values ≤ 0.05 were considered significantly enriched. Kyoto Encyclopedia of Genes and Genomes (KEGG) and Wiki pathway analyses were performed to obtain systematic and comprehensive information further identifying potential pathways among the DEGs. The GeneCodis interactive platform (https://genecodis.genyo.es/)⁵¹ was used for functional enrichment analysis. The cutoff value for significant KEGG and Wiki pathway results was an adjusted p-value below 0.05. To identify overrepresented transcription factor-binding site motifs in sequences from coregulated or coexpressed genes, Pscan⁵² was used with the selected promoter region –950 to +50 bp from the TSS and the TRANSFAC matrix sequence. Gene set enrichment analysis (GSEA) was performed with GSEA v4.1.0 software (http://software.broadinstitute.org/gsea/msigdb/index.jsp)⁵³. GSEA identifies functional enrichment by comparing genes with predefined gene sets. A gene set is a set of genes with similar localizations, pathways, functions, or other features. The input data for the GSEA were normalized counts for the SPOCK2 KD vs. GIPZ or SPOCK2 OE vs. WT gene sets; a mapping file for identifying probe sets; and a reference gene set based on the Molecular Signatures Database set: h.all.v7.4.symbols.gmt (Hallmarks) or a custom-built gene set of β-integrin signaling pathway-related genes used for enrichment analysis. The permutation number was set to 1000. The enrichment gene sets with a p value ≤ 0.05 and a false discovery rate (FDR) ≤ 0.25 in the GSEA were considered to exhibit statistically significant differences. We used the default parameters of GSEA software. An enrichment map was used to visualize the GSEA results. The enrichment score (ES) and FDR values were used to sort hallmark and β-integrin pathway-enriched gene sets. The set of genes significantly upregulated in SPOCK2-KD cells was compared via Venn diagram analysis (http://bioinfogp.cnb.csic.es/tools/venny/index.html)⁵⁴ with the set of genes downregulated in SPOCK2-OE cells.

Single-cell RNA sequencing

The SC-WT and SPOCK2 KO β-cell spheroids were dispersed, washed for flow cytometry, and filtered through a 30 μm mesh filter. Afterward, the cells were counted via Countess and adjusted to 700–1200 cells/μl. scRNA-seq was performed with the 10× Genomics platform and Illumina according to the manufacturer’s protocol. Libraries were pair-end sequenced with a depth of 40,000 reads per cell. The raw scRNA-seq data were processed with bcl2fastq v2.20 to demultiplex samples and convert the .bcl files to .fastq format. For initial data processing and some basic analyses, 10x Genomics Cell Ranger pipelines and the Seurat R package⁵⁵ were used. Cell Ranger incorporates the STAR RNA-seq aligner, reads were aligned to the hg38 reference genome and filtered, unique molecular identifiers were counted, and gene‒barcode matrices were generated for each cell. WT and KO data aggregation was performed with the “cellranger agrr” algorithm. To identify distinct cell populations on the basis of shared and unique patterns of gene expression, we performed κ-means and graph-based clustering. Prior to clustering, principal component analysis (PCA) was run to determine the meaningful variance before both. Single-cell data visualization with the UMAP algorithm, analysis of DEGs, violin plots and bubble plots with gene expression patterns were performed with either Loupe Browser 6.2.0 software (10x Genomics, USA) or R Studio with the Seurat package. To model the relationship between gene expression and the S and G2M cell cycle scores on the basis of canonical markers, the Cell-Cycle Scoring algorithm provided in Seurat package was used⁵⁶. In short, the algorithm assigns each cell a score on the basis of the expression of genes associated with the S and G2M phases of the cell cycle. For the threshold, cells with S and G2M scores exceeding the median values for the SC-β-cell cluster were classified as proliferating. Cells with both S scores and G2M scores below the median scores for their respective phases were classified as G1 phase.

Lentivirus production

HEK293T cells were used to seed 10 cm² plates one day before transfection at 70% confluence in DMEM (Corning) supplemented with 10% FBS (GE Healthcare) and 1× penicillin/streptomycin medium. The pGIPZ-based shRNA plasmids for SPOCK2 knockdown (SPOCK2 KD) were obtained from the Cell-Based Assay Screening Core at the Baylor College of Medicine, Houston, TX, USA. We assessed the efficiency of two different SPOCK2 shRNAs. The following hairpin sequence was used to establish the stable SPOCK2-KD cell line:

TGCTGTTGACAGTGAGCGACGTGAAACTCCATGGAAACAATAGTGAAGCCACAGATGTATTGTTTCCATGGAGTTTCACGGTGCCTACTGCCTCGGA

For lentivirus production, the packaging vectors psPAX2 (12 μg) and pMDG (6 μg) and 18 μg of SPOCK2 shRNA plasmid (SPOCK2 KD) or the GIPZ control plasmid encoding a scrambled shRNA were used. HEK293T cells were transfected with plasmids via Lipofectamine 3000 (Thermo Fisher Scientific) in accordance with the manufacturer’s protocol. The transfected cells were incubated for 6 h, and the medium was then replaced with DMEM (Corning) supplemented with 10% FBS (GE Healthcare) and 1× penicillin/streptomycin. The medium was replaced on each of the next three days. The supernatants were collected and passed through a 0.45 μm filter (Millipore), and the viral particles were concentrated by ultracentrifugation at 98,250 × g for 2 h at 4 °C, with the centrifuge brakes off. The viral pellets were resuspended in 200 μL of sterile PBS and stored at –80 °C.

Lentiviral transduction and cell isolation

Two days before lentiviral transduction, EndoC-βH1 cells were seeded in six-well plates at a density of 8 × 10⁵ cells/cm². For transduction, the cell medium was supplemented with 8 μg/mL polybrene (Sigma‒Aldrich) and 50 μL of concentrated virus suspension: either SPOCK2 KD or GIPZ. The cells were incubated at 37 °C in an atmosphere containing 5% CO₂ for 72 h. The medium was then replaced with fresh medium of the same composition supplemented with 3 μg/mL puromycin. Antibiotic selection was performed over a period of two weeks.

SPOCK2 OE construct

SPOCK2 cDNA was amplified from total EndoC-βH1 cDNA with the following primers:

hSPOCK2_OE_FOR:AGCGCTACCGGACTCAGATCATGCGCGCCCCGGGCTGCGG hSPOCK2_OE_REV:CACGCGTCATGGTGGCGGCGGACCAGATGTAGCCCCCGTCGTCAGCCTC

The primers were designed with the Benchling Assembly Wizard tool (https://benchling.com). SPOCK2 cDNA was amplified via PCR with Q5 polymerase (NEB) according to the manufacturer’s instructions, with touchdown PCR cycling conditions⁵⁷. The cycling conditions were as follows: 98 °C for 30 s, followed by 16 cycles of 98 °C for 20 s, 72 °C (−0.5°C/cycle) for 20 s, and 72 °C for 30 s; 30 cycles of 98 °C for 20 s, 70 °C for 20 s, and 72 °C for 30 s; and a final extension step at 72 °C for 5 min. The resulting SPOCK2 PCR product was isolated with the Monarch DNA Gel Extraction Kit (NEB). The pEGFP_N1_FLAG vector⁵⁸ was a gift from Dr. Patrick Calsou (Addgene, #60360). This vector was digested with the BamHI and BglII restriction enzymes (Thermo Fisher Scientific). Then, NEBuilder HiFi DNA Assembly Cloning (NEB) was used to ligate the SPOCK2 PCR product after verification by Sanger sequencing. EndoC-βH1 cells were transfected with the plasmid with Lipofectamine 3000 (Thermo Fisher Scientific) according to the manufacturer’s protocol.

Transient transfection with siRNA

EndoC-βH1 cells were transfected with MISSION esiRNA targeting human SPOCK2 (Sigma‒Aldrich) using Lipofectamine 3000 (Thermo Fisher Scientific) according to the manufacturer’s protocol. We used 300 ng of esiRNA/well to transfect cells growing on a 48-well plate; 72 h post transfection, the EndoC-βH1 cells were fixed and stained.

The cDNA esiRNA target sequence was as follows:

CCGTGAAACTCCATGGAAACAAAGACTCCATCTGCAAGCCCTGCCACATGGCCCAGCTTGCCTCTGTCTGCGGCTCAGATGGCCACACTTACAGCTCTGTGTGTAAGCTGGAGCAACAGGCGTGCCTGAGCAGCAAGCAGCTGGCGGTGCGATGCGAGGGCCCCTGCCCCTGCCCCACGGAGCAGGCTGCCACCTCCACCGCCGATGGCAAACCAGAGACTTGCACCGGTCAGGACCTGGCTGACCTGGGAGATCGGCTGCGGGACTGGTTCCAGCTCCTTCATGAGAACTCCAAGCAGAATGGCTCAGCCAGCAGTGTAGCCGGCCCGGCCAGCGGGCTGGACAAGAGCCTGGGGGCCAGCTGCAAGGACTCCATTGGCTGGATGTTCTCCAAGCTGGACACCAGTGCTGACCTCTTCCTGGA

Deletion of the SPOCK2 (KO) gene in hPSCs

sgRNAs targeting exon 1 of SPOCK2 were designed via Benchling software. The sgRNA sequences are listed below:

sgRNA_SPOCK2_1 CTGGCCGAAGGCGACGCCAA

sgRNA_SPOCK2_2GTCCTCCATGAAATTGCCGG sgRNA_SPOCK2_3 CTTGCCGCTGTACTGCGAGA

The sgRNAs were produced in-house. The PCR template consisted of 120-nucleotide single-stranded DNA, including a T7 promoter, sgRNA target-specific sequences, and constant sgRNA sequences. The PCR product was used for in vitro transcription to generate sgRNAs. On the day of transfection, doxycycline-treated HUES8-iCas9 hPSCs were dispersed into single cells via TrypLE Express, counted, and seeded with medium supplemented with ROCKi into Geltrex-coated 24-well plates at a density of 1.5 × 10⁵ cells/well. The cells were reverse transfected via Lipofectamine RNAiMax (Thermo Fisher Scientific, Netherlands). The medium was changed the next day, and the cells were cultured for an additional 24 h. Subsequently, the cells were plated at single-cell density and cultured for 7 days. After 7 days, selected colonies grown from a single cell were picked. PCR of genomic DNA isolated from the clones with primers flanking the CRISPR-edited region and Sanger sequencing allowed the identification of clones with homozygous KO mutations in the SPOCK2 gene. CRISPR editing efficiency was calculated via the bioinformatic tool Inference of CRISPR Edits (ICE; synthego.com, USA) on the basis of DNA-sequencing data comparisons of edited and control samples.

IncuCyte analysis

An IncuCyte live cell imager (Sartorius) was used to track living cells. EndoC-βH1 SPOCK2 KD, SPOCK2 OE, GIPZ control and WT cells were seeded into 96-well plates, which were subsequently incubated for seven days at 37 °C in an atmosphere containing 5% CO₂. Photomicrographs were taken every four hours, and the confluence of the cultures was measured in real time with IncuCyte Base Analysis Software (Sartorius). Cell proliferation was monitored by analyzing the area of the image occupied by cells (% confluence) over time. We also used the IncuCyte Cell-by-Cell Analysis Software Module to count the number of phase objects over time as an alternative method of quantifying cell proliferation.

Electron microscopy

To analyze the granular ultrastructure, EndoC-βH1 was fixed at RT for 2 h in a mixture containing 1.25% PFA, 2.5% glutaraldehyde, and 0.03% picric acid in 0.1 M sodium cacodylate buffer (pH 7.4). The samples were then washed in 0.1 M cacodylate buffer and postfixed at RT with a mixture of 1% OsO₄/1.5% KFeCN₆ once for 2 h and then once for 1 h. After washing with water, the samples were stained in 1% aqueous uranyl acetate for 1 h, washed, and subsequently dehydrated. A 1 h incubation in propylene oxide was followed by infiltration overnight in a 1:1 mixture of propylene oxide and TAAB Epon, after which the samples were embedded in TAAB Epon. The cut sections were then stained with 0.2% lead citrate. A JEOL 1200EX transmission electron microscope or a TecnaiG2 Spirit BioTWIN was used to analyze the samples.

In vivo transplantation of SC-derived β-cells and human islets

In brief, saline (sham-operated) or cells were injected into the kidney capsules of ~6-week-old (at least 21 g) male SCID-Beige animals (Harlan). The animals were anesthetized with Avertin (250 mg/kg) delivered intraperitoneally under aseptic conditions. The surgical site was shaved and disinfected with alcohol and betadine. Using a syringe, ~50 μl of the cell mixture was injected under the capsule of the left kidney. After surgery, the animals were administered 5 mg/kg carprofen for 2 days. The mice were housed individually and observed for the appearance of visible tumors. At 3 weeks post surgery, the mice were subjected to glucose tolerance tests (GTTs). All animal experiments were performed in accordance with the International Animal Care and Use Committee (IACUC) regulations under the animal protocol AN-6037.

STZ-induced diabetes in mice

Some mice with SC-β-cells transplanted under the kidney capsule received one intraperitoneal injection of streptozotocin (150 mg/kg) and underwent GTTs two months later.

Glucose tolerance test and glucose-stimulated human C-peptide secretion in vivo

The mice were fasted overnight (16 h) with water only in cages in which wire mesh flooring separated the animal from its bedding. Glucose was injected intraperitoneally (3 g/kg), and blood samples were taken from the tail and collected into heparin-coated tubes (BD) before (0) and 15, 30 and 60 min after glucose injection. A handheld glucometer (Accu-Chek, Roche) was used to measure blood glucose levels.

Before (0) and at 15, 30 and 60 min after glucose injection, blood samples were collected and spun, and the supernatant was stored at −80 °C. The levels of human C-peptide were measured via an ELISA specific to human, not mouse, C-peptide (ultrasensitive C-peptide human ELISA; Mercodia). Age-matched controls included samples from animals that had received saline only (sham-operated) or human islets (positive controls) and that had been subjected to GTTs in parallel. To verify the functionality of the SC-β-cell graft, the engrafted kidney was removed 4 months after streptozotocin (STZ) injection. The kidney was removed after the renal vein, artery and ureter were ligated. Following removal, the mice were fasted, and their glucose levels were measured. Mice with blood glucose >20 mmol/l were treated with daily insulin (0.5 μ/kg) after glucose measurement.

FACS analysis

The cells were dissociated with trypsin to obtain a single-cell suspension and fixed by incubation with 4% paraformaldehyde in PBS supplemented with 0.1% saponin for 30 min at room temperature. The samples were washed once with 0.1% saponin–1% BSA–PBS (SBP). The resuspended cells were then incubated overnight at 4 °C on a roller with an anti-SPOCK2 (Sigma Aldrich) antibody diluted in SBP. The following day, the cells were washed twice with SBP and incubated with secondary antibodies conjugated with TRITC or Alexa Fluor 647 (Jackson ImmunoResearch) diluted 1:800 in SBP for 1 h at room temperature. The excess secondary antibodies were removed by washing once with PBS, and the cells were resuspended in PBS and used directly for FACS analysis. Flow cytometry data were acquired with a CytoFLEX Flow or Aria II flow cytometer (Beckman Coulter) or CYTEK Aurora. Flow cytometry data analysis, including gating, quantification, and the generation of density plots/histograms, was performed with CytoExpert v2.4 or Aria software (Beckman Coulter) or CYTEK Aurora. FACS enrichment for CD49a⁺ and TM4SF4^– was performed on SC-β-cells. The cells were plated on laminin-coated plates overnight for recovery.

Statistics

All the graphs were prepared in GraphPad Prism 8. For statistical analyses, unpaired two-tailed Student’s t tests or one-way ANOVA for multiple comparisons were performed. All values are shown as the means ± SDs.

• SEO Powered Content & PR Distribution. Get Amplified Today.
• PlatoData.Network Vertical Generative Ai. Empower Yourself. Access Here.
• PlatoAiStream. Web3 Intelligence. Knowledge Amplified. Access Here.
• PlatoESG. Carbon, CleanTech, Energy, Environment, Solar, Waste Management. Access Here.
• PlatoHealth. Biotech and Clinical Trials Intelligence. Access Here.
• Source: https://www.nature.com/articles/s12276-024-01380-2