Skin graft with dermis and appendages generated in vivo by cell competition – Nature Communications

Ethics declarations

In this study, we injected HaCaT cells to amniotic cavity of E13.5 mouse fetus to transplant human keratinocyte cells, (see “In utero injection” below). This is different from human PSC-derived chimeras with preimplantation animal embryos, which potentially generate systemic human-animal chimeras. We also used HaCaT cell line as a graft instead of human primary keratinocyte. Therefore, described HaCaT cells-derived chimera study was able to be performed under the approval of the animal care and use committee of the Institute of Medical Science, the University of Tokyo (Permission No. PA21-16, PA21-47)

Animals

C57BL/6N, ICR, C57BL/6N-Tg (CAG-EGFP), and DBA/2 mice were purchased from SLC Japan (Shizuoka, Japan) and were reared under the prescribed conditions (light: a.m. 8:00–p.m. 20:00/dark: p.m. 20:00–a.m. 8:00). All experiments were performed in accordance with the animal care and use committee guidelines of the Institute of Medical Science, the University of Tokyo (Permission No. PA21-16, PA21-47).

Cell culture

The ESCs of SGE2²⁶ (C57BL/6N-Tg(CAG-EGFP) mESC) and B6ES2 (C57BL/6N mESC) were cultured on mitomycin C-(Fujifilm Wako Pure Chemical Corporation, Tokyo, Japan, Catalog No. 139-18711)-treated mouse embryonic fibroblasts in N2B27 medium (Invitrogen, Catalog No. 11330-032, 21103-049, 17502048, 17504044) containing 3.0 μM CHIR99021 (Axon Medchem, Groningen, Netherlands, Catalog No. Axon1386), 1.0 μM PD0325901 (Fujifilm Wako Pure Chemical Corporation, Tokyo, Japan, Catalog No. 162-25291), 1000 U/ml of leukemia inhibitory factor (Millipore, Billerica, MA, Catalog No. ESG1107).

HaCaT (human immortalized keratinocytes, male) were purchased from Cell Line Service (Germany, Product No. 300493) and were cultured in CnT-07 medium (CELLnTEC, Bern, Switzerland, Catalog No. CnT-07) and transduced with a CAG-EGFP expressing lentiviral vector (HaCaT-EGFP).

Embryo culture, electroporation, and micromanipulation

To obtain ICR zygotes or BDF1-EGFP zygotes (C57BL/6N-Tg(CAG-EGFP) females crossed with DBA/2 males), in vitro fertilization was performed in HTF medium (ARK-Resource, Kumamoto, Japan).

For genome editing, Cas9 RNP electrode with 200 ng/µl p63 sgRNA; CACGGATAACAGCGCCCTGT (Integrated DNA Technologies, Iowa, USA), 100 ng/µl Sp.Cas9 protein (Integrated DNA Technologies, Iowa, USA, Catalog No. 1081059) in Opti MEM (Invitrogen, Carlsbad, CA, Catalog No. 31985-062) was introduced into zygotes by electroporation³² using the Genome Editor (BEX, Tokyo, Japan). For p63 knockout chimera generation, SGE2 mESCs were injected into the preimplantation ICR embryos at the 4–8 cell stage on F0 generation of the p63 genome editing. B6ES2 mESCs were injected into the BDF1-EGFP embryos at the 4–8 cell stage on F0 generation of the p63 genome editing. The chimeric embryos were cultured in KSOM/AA medium (Millipore, Billerica, MA, Catalog No. MR-101-D) until blastocyst stage and transferred into the uterus of pseudo-pregnant ICR mice. The sex of embryos was not considered. All donor mESCs are male.

Genotyping

To extract the genomic DNA, the tails of p63 knockout mice were lysed with lysis buffer (Tris-HCl pH8.0 20 mM, NaCl 100 mM, five mM EDTA, 0.1% SDS) containing 400 µg/ml proteinase K (Sigma-Aldrich, St. Louis, MO, Catalog No. P6556) at 60 °C for 5 min and 98 °C for 2 min. To detect p63 mutation, the targeted region was amplified by PCR (Genotyping Forward primer: CACGTTTGTACAAGCCAGAACTTA, Genotyping Reverse primer: TCTTTTGGTCTTCCCGAGCCT) using KOD-multi & Epi- (Toyobo, Osaka, Japan, Catalog No. KME-101). The amplicons were column-purified and directly sequenced by Sanger sequencing, or following the cloning on pUC19. The data were analyzed using TIDE³³. When we found unexplainable results by TIDE analysis, we additionally verified the genotype using NGS-based genotyping. Illumina libraries were constructed with in-house custom index primers (Supplementary Data 2). The multiplex libraries were sequenced by Illumina HiSeq X (150 bp, paired end). The data were analyzed using Cas-analyzer³⁴ (Supplementary Fig. 2).

For genotyping of p63 knockout chimera, liver and spleen were hemolyzed in Ammonium-Chloride-Potassium (ACK) buffer and stained with CD45 antibody (1:100, clone 30-F11, eBioscience, Catalog No. 17-0451-82) for 30 min. Genotype was confirmed by host embryos-derived fibroblast (E9.5), fetal liver CD45+ cells (E14.5), and splenocytes (E18.5) following cell sorting by FACS aria II or III (BD).

Flow cytometry

The skin was harvested from p63 knockout chimera and WT-chimera and digested in CnT-07 medium supplemented with 25 U/ml dispase (Gibco, Life Technologies, Carlsbad, CA, Catalog No. 17105-041) at 4 °C, 12–24 h. Epidermis isolated from the skin was digested with accutase (Innovative Cell Technologies, California, USA, Catalog No. AT-104) to prepare single-cell suspensions. Samples were stained with anti-CD45 (1:100, clone 30-F11, Biolegend, Catalog No. 103126), anti-CD117 (1:100, clone 2B8, eBioscience, Catalog No. 105814), and anti-CD49f (1:100, clone GoH3, eBioscience, Catalog No. 17-0495-82) antibodies for 30 min on ice. Spleens were dissociated into single cells by pipetting, hemolyzed in ACK buffer, and stained with anti-CD45 antibody (1:100, clone 30-F11, eBioscience, Catalog No. 17-0451-82) for 30 min.

Each sample was stained with Propidium iodide (PI) (Sigma-Aldrich, St. Louis, MO, Catalog No. P4170) or 4’,6-diamidino-2-phenylindole (DAPI) (Invitrogen, Carlsbad, CA, Catalog No. D1306) and analyzed by CytoFLEX S (B75442, BECKMAN COULTER, California, USA). The chimerism of each tissue was calculated by referring to the EGFP signal using FlowJo software (BD biosciences, New Jersey, USA).

Macroscopic analysis/Mosaic distribution calculation

The fetuses (E9.5, E14.5, E18.5) obtained by Cesarean section were photographed under a fluorescence microscope (LEICA M165 FC). The percentage of skin areas in WT-chimera or p63 knockout-chimeras at E18.5 were estimated according to the EGFP signal. The number of pixels of adjacent basal layers was measured in immunofluorescence staining images of WT chimera or p63 knockout chimera at E14.5. Total EGFP⁺ or EGFP⁻ areas were summed, respectively, and the frequency of occurrence per pixel (expected value) was calculated from Formula 1. Next, the probability of EGFP⁺ and EGFP⁻ regions in a sequence of adjacent regions were calculated from Formula 2. The mosaic distribution was quantitatively compared by taking the logarithm of the obtained expected values:

Formula 1:

Formula 2:

Histological analysis

Tissues were fixed in 4% paraformaldehyde at 4 °C for 24 h and then replaced with PBS. Fixed tissues were embedded in paraffin blocks by a routine procedure, and HE-stained and unstained slides were prepared.

Tissue sections were deparaffinized in xylene and ethanol and autoclaved at 120 °C for 20 min in citric acid buffer at pH 6.0 for antigen retrieval.

Blocking was performed at room temperature for 30 min by MAXblock (Active motif, California, USA, Catalog No. 15252). Tissue sections were incubated with the primary antibody at 4 °C for 1–2 h or overnight, washed in PBS, and incubated with the secondary antibody at room temperature for 2 h. Primary antibodies: mouse anti-p63 (1:100, clone D-9, sc-25268, Santa Cruz), rabbit anti-Cytokeratin 1 (1:200, polyclonal, ab93652, Abcam), rabbit anti-Cytokeratin 5 (1:200, clone EP1601Y, ab52635, Abcam), rabbit anti-Cytokeratin 10 (1:200, clone EP1607IHCY, ab76318, Abcam), rabbit anti-Cytokeratin 14 (1:200, clone EPR17350, ab181595, Abcam), rabbit anti-Cytokeratin 8/18 (1:200, clone EP1628Y, ab53280, Abcam), rabbit anti-Loricrin (1:200, polyclonal, ab85679, Abcam), rabbit anti-Involucrin (1:200, clone EPR13054, ab181980, Abcam) and goat anti-GFP (1:200, polyclonal, ab6673, Abcam). Secondary antibodies: Donkey anti-goat IgG Alexa Fluor 488 (1:1000, A11055: Invitrogen), Donkey anti-mouse IgG Alexa Fluor 568 (1:1000, A10037: Invitrogen), Donkey anti-rabbit IgG Alexa Fluor 568 (1:1000, A10042: Invitrogen) and Donkey anti-rabbit IgG Alexa Fluor 647 (1:1000, A31573: Invitrogen). Samples were washed with PBS and mounted with Dako fluorescent mounting medium (DAKO, CA, United States, Catalog No. S3023). TUNEL staining (Click-iT™ TUNEL assay, C10619, Invitrogen) was performed according to the manufacturer’s protocol. A sample without TUNEL staining was prepared as a negative control, and a sample treated with DNase was prepared as a positive control. As for the human skin segment, frozen sections were prepared by immersing the tissue in OCT compound (Sakura Finetek Japan, Tokyo, Japan, Catalog No. 4583), cooling at −80 °C, slicing to 7 μm using a cryostat (Leica, CM3050S), and performing antibody staining. Images were acquired using confocal laser scanning microscopy (FV3000; Olympus, Tokyo, Japan).

Single cell RNAseq

The skin of WT (C57BL/6N background) fetuses at E14.5 was soaked in dispase and separated into the epidermis and dermis. The single cells of the WT epidermis by treated with trypsin. The p63 knockout fetuses (C57BL/6N background) were directly digested with trypsin. Samples were stained with following antibodies: anti-mouse CD45 (1:100, clone 30-F11, eBioscience, Catalog No. 103126), TER119 (1:100, clone TER-119, eBioscience, Catalog No. 25-5921-82), anti-CD140a (1:100, clone APA5, Biolegend, Catalog No. 135908). The single cell of the PI⁻/CD45⁻ /TER119⁻/CD140a⁻ population was sorted by FACS aria II or III (BD). The cDNA library was prepared by SMART-Seq HT (Takara Bio Inc., Shiga, Japan, Catalog No. 634438) and purified with AMPure XP beads (BECKMAN COULTER, California, USA, Catalog No. A63881). We screened samples by qPCR with Taqman Fast advanced Master Mixusing Quant studio 7 (Applied Biosystems, Massachusetts, USA, Catalog No. 4444557). Gapdh (Forward primer: TGGAGAAACCTGCCAAGTATG, Reverse primer: TGGGAGTTGCTGTTGAAGTC, Probe: CATCAAGAAGGTGGTGAAGCAGGC) was used as a reference gene for sample screening, and samples with significant amplification of Krt5 (Forward primer: TGAACCGAATGATCCAGAGG, Reverse primer: GCTCTGTCAGCTTGTTTCTG, Probe: AACGTCAAGAAGCAGTGTGCCAAC) or Krt8 (Forward primer: GATGCAGAACATGAGCATTCA, Reverse primer: CATTCCGTAGCTGAAGCCAG, Probe: CGGCTACTCAGGAGGACTGAGTTCA) were selected (Krt5 for WT keratinocytes, Krt8 for p63 knockout keratinocytes). We also confirmed that Pdgfra (Forward primer: AAAAGCAGGCTCTCATGTCT, Reverse primer: AGTAGTTGACCAAATCCCCA, Probe: TGCACCAAGTCAGGTCCCATTTACA) was not significantly amplified. Using selected samples, we prepared to Illumina library by Nextera XT (Illumina, California, USA, Catalog No. FC-131-1024) with a slightly-modified protocol and sequenced by Hiseq (150 bp paired end). At each step, we performed a quality check of the cDNA and Illumina libraries by Tapestation (Agilent, California, USA). We first mapped the data to mm10 by HISAT2³⁵ (Galaxy Version2.1.0+galaxy5) on Galaxy³⁶ (version20.05) and counted by Feature Counts³⁷ (Galaxy Version 1.6.4+galaxy2) based on the GTF file of Ensemble³⁸, version-release.97. Transcript integrity number (TIN) and Gene Body Coverage were analyzed by RSeQC³⁹ (Galaxy Version 2.6.4.1 and Galaxy Version 2.6.4.3) to exclude low-quality samples. The count was normalized by DESeq2⁴⁰ (version1.38.2) and analyzed for differentially expressed genes (DEGs). The p value was calculated using a two-sided Wald test. We visualized the data using iDEP⁴¹ (version0.96) or R⁴² (version3.6.0 and 4.2.2). Boxplots for visualization of gene expression are generated using the ggplotgui package (https://site.shinyserver.dck.gmw.rug.nl/ggplotgui/).

Skin grafting

Skin grafts were harvested from E18.5 fetuses (see Fig. 3d). Adipose tissue was removed from the harvested skin. The back skin of the recipient mice was excised, and the skin grafts were sutured with 5-0 nylon. The skin grafts were fixed by tie-over fixation with sutures and gauze, and then adhesive tape was applied around the trunk. Seven days later, the tie-over fixation was removed, and photographs were taken every 2–3 days to confirm the viability of the skin grafts. Furthermore, we performed the histological analysis with biopsied samples of engrafted skin grafts at 1.5 months and 3 months after transplantation.

In utero injection

Pregnant mice at E13.5 implanted with p63 knockout fertilized eggs were abdominally opened under inhalation anesthesia.

The cell suspension of HaCaT-EGFP (1.0 × 10⁷ cells/100 µl CnT-07) was injected transuterine into the amniotic cavity with a 27G needle syringe. We obtained the fetuses at E18.5 by Cesarean section. We performed macroscopic fluorescence analysis and histological analysis.

Statistics and reproducibility

All experiments are performed at least three independent trials. Statistical analysis was performed with GraphPad Prism v.8.4.3. The comparison between multiple groups was performed by Repeated Measures ANOVA (Friedman’s test) and post hoc test by Dunn’s multiple comparison test. A p value less than 0.05 was considered significant.

Reporting summary

Further information on research design is available in the Nature Portfolio Reporting Summary linked to this article.

• SEO Powered Content & PR Distribution. Get Amplified Today.
• PlatoData.Network Vertical Generative Ai. Empower Yourself. Access Here.
• PlatoAiStream. Web3 Intelligence. Knowledge Amplified. Access Here.
• PlatoESG. Carbon, CleanTech, Energy, Environment, Solar, Waste Management. Access Here.
• PlatoHealth. Biotech and Clinical Trials Intelligence. Access Here.
• Source: https://www.nature.com/articles/s41467-024-47527-7