Orthotopic transplantation of the bioengineered lung using a mouse-scale perfusion-based bioreactor and human primary endothelial cells – Scientific Reports

Animal husbandry

All animals in this study were maintained under a specific pathogen-free condition in the animal experiment facility at Tohoku University. All experiments were performed in accordance with the Regulations for Animal Experiments and Related Activities at Tohoku University (15^th edition), published by Tohoku University (https://www.clag.med.tohoku.ac.jp/clar/en/). This study was approved by the Institutional Animal Care and Use Committee at Tohoku University (#2020AcA-041-01). This study is reported in accordance with ARRIVE guidelines.

Mouse surgery

C57Bl6 mice were purchased from Charles River (Japan). Male mice weighing between 25 and 30 g (12-week-old or older) were used for the surgery. Surgical procedures were performed under a surgical microscope M525 (Leica, Germany) or a stereomicroscope (Zeiss, Switzerland). Mice were euthanized with an overdose of isoflurane. The mice were fixed in the supine position. The abdominal and thoracic cavity were opened through the median incision. Then the inferior vena cava and the superior vena cava were ligated. The descending aorta was cut in the abdominal cavity to drain the blood, and then 3 mL of PBS was injected via the right ventricle to flush the pulmonary circulation. Once both lungs were adequately flushed, a 2 mm window was made under the tricuspid valve using scissors, and a 3F rat jugular vein catheter (#C30PU-RJV130, Instech/Primetech, Tokyo) was inserted into the pulmonary artery through the window. The catheter was fixed by ligating the root of the PA. Then an 18G I.V. catheter (Terumo, Tokyo) was inserted into the trachea and fixed by a ligation. Then the heart–lung block (HLB) was removed from the thoracic cavity after cutting down the adjacent vessels and tissues. The procedure was summarized in supplementary Fig. 1.

Decellularization of the lung

Mouse lung decellularization was performed according to the previous literature with minor modifications¹⁰. Each liquid injection was performed through the PA or tracheal catheters. First, incubate the heart–lung blocks in distilled and deionized water (DDI) for 1 h at 4 °C. Then, 0.1% Triton-X (Sigma, Japan) in DDI was injected and incubated for 24 h at 4 °C followed by 24-h incubation with 2% sodium deoxycholate in DI. On the final day of the procedure, the heart–lung blocks were incubated with 1 M NaCl for 1 h at room temperature, followed by 1 h incubation with 0.1% DNaseI (Sigma, Japan). After rinsing with PBS, the heart–lung blocks were stored in PBS/antibiotics at 4 °C up to two weeks until use.

Cell culture

Human umbilical vein endothelial cells (HUVEC, Lonza, Japan) were cultured using an EGM-2 Endothelial Cell Growth Medium-2 BulletKit (Lonza) as manufacturer’s instruction. Cells were maintained in a CO₂ incubator at 37 °C. Cells between passage 2 and passage 5 were used for the experiments.

Perfusion-based bioreactor assembly and perfusion organ culture

An in-house developed perfusion-based bioreactor was assembled as described in Fig. 3a. For gravity-driven cell injection, HUVECs were suspended in a glass bottle at a concentration of 1 × 10⁶/mL, and the bottle was placed approximately 30 cm above the organ chamber. A decellularized mouse heart–lung block was connected to the tubing through the PA catheter, and then, a stopcock was opened to allow the cells to be injected into the decellularized pulmonary vasculature. After the cell suspension was completely injected into the heart–lung block, the perfusion circuit was connected to a pulsatile pump (Masterflex L/S Digital Precision Modular Drive, Cole-Parmer, IL), and the media was perfused at a rate of 2 mL/min (or 6 rpm) using a Benchtop Controller (Cole-Parmer).

At the end of the perfusion-bioreactor culture, the recellularized heart–lung block was divided into individual lobes, and the lobes were either fixed in 10% neutralized formalin or immersed in RNAlater (ThermoFischer Scientific) and stored in a -80 °C freezer.

RNA extraction and qPCR

The frozen tissue was later homogenized in Buffer RLT (Qiagen, Japan) using TissueLyserII (Qiagen). Total RNA was extracted using an RNeasy mini kit (Qiagen) according to the manufacturer’s instructions. cDNA was reverse transcribed using iScript reverse transcription supermix (Biorad Laboratories, Japan) according to the manufacturer’s instructions. qPCR was performed using ssoAdvanced Universal SYBR Green Supermix (Biorad Laboratories) with CFX96 Real-Time PCR Detection System (Biorad Laboratories). The primers used for this study are; PrimePCR™ SYBR® Green Assay GAPDH, Human (Unique Assay ID: qHsaCED0038674), CD34, Human (Unique Assay ID: qHsaCID0007456), CDH5, Human (Unique Assay ID: qHsaCID0016288), KDR, Human (Unique Assay ID: qHsaCID0006310), and Pecam1 (Forward sequence: CCACGCCTAGCCAAAATCAC, Reverse sequence: CATGTGGCCCCTCAGAAGAC), all purchased from Biorad Laboratories.

Histology

Formalin-fixed and paraffin-embedded tissue was cut into 3 µm slices. Hematoxylin–eosin staining (HE), Masson’s trichrome staining (MT), and combined Verhoeff and Masson trichrome staining (VMT) were performed under the standard protocols. For immunohistochemistry, a heat-induced antigen retrieval procedure was performed using an Histofine antigen-retrieval solution pH 9 (Nichirei Bioscience, Japan) by incubating sections under 120 °C degree for 15 min in an autoclave. Sections are then incubated with a specie-matched blocking serum for 30 min, followed by an overnight incubation with a primary antibody. The following day, antibody reactions are visualized using Histofine Simple Stain MAX PO (Nichirei Bioscience) and DAB chromogen (Nichirei Bioscience). For immunofluorescence of CD31, an AlexaFluore 488 goat anti-rabbit IgG was applied to the tissue section after the overnight incubation of a primary andibody for CD 31. The sections were then mounted using ProLong Gold antifade mounting medium with DAPI (ThermoScientific, MA). Primary antibodies used in this study are; rabbit anti-human CD31 polyclonal antibody (1:50, Santa Cruz, TX), mouse anti-human alpha-smooth muscle actin antibody(1:50, BioLegend, CA), rabbit anti-human laminin polyclonal antibody (1:300, Abcam, UK).

Images were digitally captured using SLIDEVIEW VS200 (Olympus/Evident, Japan) with a 200 times magnification. Images were processed using the OlyVIA image processing software (Olympus/Evident). For immunofluorescence imaging, fluorescent signals were captured using Leica confocal lase microscope (TSC Sp8, Leica) and Las X image processing software (Leica).

Image analysis

The pixel number of the scaffold area was counted by selecting the edge of the scaffold (Fig. 5b). Then, the HE images of decellularized, recellularized, and native lungs (Fig. 5a and Supplementary Fig. 2) were converted into binarized images and made pixels transparent according to the brightness threshold above 190 and the gray scale value as 35 (Fig. 5c). The number of black pixels of the converted images was counted, and the percentage of pixel counts of the cells to the scaffold area was used as a vascular coverage of HUVECs (Fig. 5d). Then, the box-counting (Fig. 5e) was performed using the image analysis program PoreSpy (https://porespy.org/)²⁷ using the converted images. The results were plotted in log–log graphs to estimate fractal dimensions, and the fractal dimension of each image was calculated as a slope of the linear fit line of these plots (Fig. 5f and Supplementary Fig. 2).

The difference in cell coverage was tested using one-way ANOVA. And the fractal dimensions of decellularized and recellularized mouse lungs were analyzed with Kruskal–Wallis test followed by Dunn’s multiple comparison test using Prism (Version 10, GraphPad).

Transmission electron microscopy

Decellularized and recellularized lung tissues were perfused with a fixative composed of 2% of paraformaldehyde, 2.5% of glutaraldehyde, and 0.1 M cacodylate buffer overnight at 4 °C. The tissues were cut into small pieces and incubated with 0.1 M cacodylate buffer for 24 h at 4 °C. Then the tissues were further fixed with 1% osmium tetroxide for 90 min and dehydrated in a graded series of ethanol. For micro-sectioning, the tissues were embedded into epoxy resin and cut into 80 nm slices using Leica EM UC-7. Finally, the sections were stained with 2% uranium acetate, followed by a 1% mixture of lead acetate, lead nitrate, and lead citrate. Images were captured using an electron microscope JEM-1400 (Japan Electron Optics Laboratory, Japan). To quantify the distribution of HUVECs in different vascular locations, total of 169 cell positions were captured. The caliber of the capillary vessel to which an individual endothelial cell was attached was represented as the diameter of the circle inscribing the vascular scaffold (Fig. 6h and Supplementary Fig. 3, orange dotted circles).

Orthotopic transplantation of the bioengineered lung

Orthotopic bioengineered mouse left lung transplantation was performed using our previously described cuff technique^28,29, with modifications. Briefly, after a three-day perfusion bioreactor culture, the left pulmonary hilum of the bioengineered lung was dissected. A cuff made with a 24G angiocatheter was attached to left pulmonary artery, and cuffs made with a 20G angiocatheter were attached to the pulmonary vein and bronchus. Recipient mice were anesthetized with an intraperitoneal injection of a triple mixture of medetomidine hydrochloride (0.75 mg/kg), midazolam (4 mg/kg) and butorphanol tartrate (5 mg/kg) and were intubated orally with a 20G angiocatheter and maintained under mechanical ventilation (Harvard 687, Harvard Apparatus) with 0.5 mL of tidal volume, 120/ min frequency, 2 cmH₂O of positive end-expiratory pressure, and 100% of inhaled oxygen concentration. A left thoracotomy is performed through the third intercostal space. After dissection of left hilum, a slip knot with 9–0 silked was used for pulmonary artery and a microvascular clamp was placed to the bronchus together with the pulmonary vein. Then left lung transplantation was performed, and the bioengineered lung was re-perfused. We performed two transplantation surgeries using bioengineered left lungs. A decellularized lung scaffold was used for cell-free control (n = 1). After reperfusion, blood was allowed to circulate for 30 min. Then, animals were sacrificed, and the graft was harvested for histological observation.

• SEO Powered Content & PR Distribution. Get Amplified Today.
• PlatoData.Network Vertical Generative Ai. Empower Yourself. Access Here.
• PlatoAiStream. Web3 Intelligence. Knowledge Amplified. Access Here.
• PlatoESG. Carbon, CleanTech, Energy, Environment, Solar, Waste Management. Access Here.
• PlatoHealth. Biotech and Clinical Trials Intelligence. Access Here.
• Source: https://www.nature.com/articles/s41598-024-57084-0