Search
Close this search box.

Near-cognate tRNAs increase the efficiency and precision of pseudouridine-mediated readthrough of premature termination codons – Nature Biotechnology

Plasmid construction

The cDNA-EGFP reporter containing ALDOB, reporter-3 and the flag-reporter plasmids was constructed as follows: the sequence with or without PTC site was inserted into the pLenti-CMV-MCS-BSD backbone by NEBuilder HiFi DNA Assembly Master Mix according to the manufacturer’s instructions. For hU6-driven gsnoRNA expression constructs, gsnoRNA fragments were amplified by a four-primer overlapping PCR strategy (one sense strand and three antisense strands) and golden-gate cloned into the pLenti-sgRNA-lib 2.0 backbone (Addgene, 89638), and the CMV-driven DKC1-iso3 can be inserted by NEBuilder HiFi DNA Assembly Master Mix according to the manufacturer’s instructions. For the hU6-driven tRNA plasmid, the tRNA fragments were synthesized by Beijing Xianghong Biotechnology Company and golden-gate cloned into the pLenti-sgRNA-lib 2.0 backbone (Addgene, 89638). The tRNA gene sequences are obtained from the tRNA database genomic tRNA database (http://gtrnadb.ucsc.edu/). For the 2× and 4× tRNA plasmid construction, the U6/H1-driven tRNA fragments were amplified separately and golden-gate cloned into the pLenti-sgRNA-lib 2.0 backbone in a certain order.

Synthesis of RNA oligonucleotides

The RNA oligonucleotides were synthesized by Nanjing Genscript Company. The tRNA oligos were chemically synthesized on solid supports of controlled pore glass using standard automated phosphoramidite chemistry and purified by high-performance liquid chromatography (HPLC). All tRNA oligos feature a 5′ phosphorylation and a 3′ CCA tail. The synthesized natural internal modifications of tRNA-R-TCT include m5C49; Ψ27, 28, 36, 39, 40, 54 and 55; m1A58; and m1G9. The tRNA oligos demonstrate a purity of 93–95% and a yield of approximately 12%.

Cell culture and transfection

HEK293T and primary MEF cells were maintained under 5% CO2 at 37 °C in DMEM medium (Gibco) supplemented with 10% FBS (Gibco) and 1% penicillin/streptomycin (Gibco). A group of 16HBEge cells was grown under 5% CO2 at 37 °C in MEM medium (Corning) supplemented with 10% FBS (Gibco) and 1% penicillin/streptomycin (Gibco). For 16HBEge cells, plates/flasks were coated before use by incubating with a thin layer of coating solution ((LHC-8 basal medium with 1.34 μl ml1, 7.5% BSA, 10 μl ml1 bovine collagen solution type 1 (Advanced BioMatrix) and 10 μl ml1 fibronectin from human plasma (Thermo Fisher Scientific)) at 37 °C/5% CO2 for 2–3 h followed by thorough removal of coating solution and storage at 4 °C. The cells were negative for mycoplasma contamination, tested by GMyc-PCR Mycoplasma Test Kit (YEASEN).

For transfection, 2.5 × 105 of HEK293T cells were seeded on 24-well plates (Corning), and all transfections were conducted when cells reached approximately 80% confluency after 20–24 h. The plasmids extracted using EndoFree Mini Plasmid Kit II (TIANGEN Biotech, DP118) or chemically synthesized RNA oligos were transfected into cells by Lipofectamine LTX reagent (Invitrogen) supplemented with PLUS reagent (Invitrogen) according to the manufacturer’s instructions.

AAV-mediated cell transduction

RESTART v3 expressing AAVs were packaged in PackGene Company. 16HBE cells were seeded at a density of 1 × 105 in 24-well plates (Corning). After 24 h of seeding, 16HBE cells (CFTR-R553X) were transduced by AAV2 at multiplicities of infection of 1 × 105. The cell medium was changed 24 h after transduction. A group of 16HBEge cells was treated with 100 µg ml1 G418. Five days after transduction and 18 h after G418 treatment, whole-cell patch-clamp experiments were performed. Besides, MEFs were seeded into 100 mm culture dishes at a density of 1.5 × 105 cells and were transduced by AAVDJ at multiplicities of infection of 5 × 106, after 24 h of seeding. The cell medium was changed 48 h after transduction, and cells were collected after 7 days.

PTC readthrough analysis

At 48–72 h post-transfection, cells were imaged using the ImageXpress Micro 4 high-content imaging system (Molecular Devices). Sixteen images from different loci of the same well were captured under a ×10 microscope and automatically analyzed using the MetaXpress software. The BFP/mCherry-positive cells are confirmed as successfully transfected cells, and the EGFP-positive cells are considered to achieve PTC readthrough. The readthrough efficiency was evaluated by the relative EGFP-positive cell percentage and relative EGFP intensity in the successfully transfected cells, which is normalized to the positive control. The overall average fold improvement is calculated for all three stop codons based on the relative EGFP intensity data in Fig. 3b and the relative EGFP-positive cell portion data in Fig. 3a.

Quantitative Ψ detection

HEK293T cells were seeded in 24-well plates and incubated for 20–24 h, followed by cotransfection of 500 ng reporter-3, 500 ng 4× tRNA/empty vector and 250 ng DKC1-iso3 constructs for detecting the modification of targeted sites. HEK293T cells were seeded in six-well plates and incubated for 24 h, followed by cotransfection of 2 μg CFTR full-length reporter and 2 μg empty vector/gctrl/RESTART v3 constructs for detecting the off-target effect. For CFTR-R553X and mIDUA-W392X disease cell models, RESTART v3 was delivered via AAV. At 48 h post-transfection, cells were collected and total RNA was extracted from cells using TRIzol reagent (Life Technologies). Next, 500 ng DNase I-treated total RNA or mRNA was fragmented to ~150 nt, then treated with 85% sulfite/15% bisulfite solution at 70 °C for 5 h. The reaction mixture was desalted by passing it through Micro Bio­spin 6 chromatography columns twice (Bio-Rad, 7326200). The desalted product was treated with 1 M Tris–HCl (pH 9.0) at 75 °C for 30 min to achieve desulfonation. Then, 50 ng RNA for each sample was subjected to library construction using SMARTer Stranded Total RNA-Seq Kit v3—Pico Input Mammalian (Takara Bio, 634485) according to the manufacturer’s protocol.

Targeted amplicon sequencing

The PRAISE-labeling was performed as described above. Then, the PRAISE-labeled RNA was used for reverse transcription (RT) with Maxima H minus Reverse Transcriptase (Thermo Fisher Scientific, EP0753). Next, the first round of on-target amplicons was PCR amplified for 15 cycles with gene-specific primers. Each primer contained a 10-nt unique molecular identifier (UMI) to enhance the accuracy. PCR products were subjected to the second round of PCR amplification with the Illumina primers for 10–20 cycles. Then, the PCR products were purified using 1× AMPure XP beads (Beckman Coulter). Library sequencing was performed on Illumina’s HiSeq 10× with paired-end 2 × 150 bp read length.

tRNA-seq

HEK293T cells were seeded in 24-well plates and incubated for 24 h, followed by cotransfection of 500 ng reporter-3, 500 ng 4× tRNA/empty vector and 250 ng DKC1-iso3 constructs or 200 ng ALDOB-EGFP reporter, 400 ng 1× tRNA plasmid/empty vector and 200 ng gsnoRNA-DKC1-iso3 constructs. At 48 h post-transfection, cells were collected and total RNA was extracted from cells using TRIzol reagent (Life Technologies). tRNA-seq was performed with the DM-tRNA-seq method46,47. Small RNA (<200 nt) was isolated and purified from cell culture using MEGAclear Transcription Clean-Up Kit (Thermo Fisher Scientific, AM1908) according to the manufacturer’s instructions. Then, 200 ng of small RNA was deacetylated in Tris 9.0. For demethylation, the small RNA was denatured at 65 °C for 5 min, chilled on ice and then demethylated in a 20 μl demethylation mixture containing a purified 3× molar ratio of D135S mutant. The demethylation reaction was incubated for 2 h at 37 °C and quenched by the addition of 5 mM EDTA (final). Demethylated RNA was purified by phenol/chloroform extraction and ethanol precipitation. The RNA pellet was dissolved in 10 μl nuclease-free water.

The library construction was performed according to the eCLIP library construction protocol with several modifications47. RNA samples were treated by PNK (NEB) for dephosphorylation of 3′ ends and were purified by ethanol precipitation, and then subjected to 3′ RNA linker ligation using T4 RNA ligase2 (NEB). The 3′ RNA linker sequence is as follows: 5′-rAPP-AGATCGGAAGAGCGTCGTG-3SpC-3′. The excess RNA adaptor was digested by adding 5′ deadenylase (NEB) and RecJf (NEB), and the RNA was purified by ethanol precipitation. Next, the RNA sample was subjected to RT reaction using TGIRT (InGex) and RT primer (ACACGACGCTCTTCCGATCT), and the excess RT primer was digested by the addition of exonuclease I (NEB). cDNA was purified using silane beads (Invitrogen) and then ligated to the 5′ adaptor (5′-Phos-NNNNNNNNNNAGATCGGAAGAGCACACGT-CTG-3SpC-3′). Ligation was performed with T4 RNA ligase1, high concentration (NEB) at 25 °C overnight. The ligated cDNA was purified using silane beads and then subjected to PCR amplification for 10–11 cycles. The PCR product was purified with 8% TBE gel. The libraries were sequenced on Illumina’s HiSeq 10× with paired-end 2× 150 bp read length.

RNA-seq

HEK293T cells were seeded in 24-well plates and incubated for 24 h, followed by cotransfection of 500 ng reporter-3, 500 ng 4× tRNA/empty vector and 250 ng DKC1-iso3 constructs. At 48 h post-transfection, cells were collected and total RNA was extracted from cells using TRIzol reagent (Life Technologies). RNA-seq was performed with the recently developed TRACE-seq method48. TRACE-seq libraries were constructed by seamless steps including RT by oligo dT primers, Tn5 transposase tagmentation, gap filling and PCR. After enrichment, the library was purified twice using 0.8× Agencourt AMPure XP beads (Beckman Coulter) and eluted in 10 μl nuclease-free water. The concentration of resulting libraries was determined by Qubit 2.0 fluorometer with the Qubit dsDNA HS Assay Kit (Invitrogen), and the size distribution of libraries was assessed by Agilent 4150 TapeStation System with High Sensitivity D1000 ScreenTape. Finally, libraries were sequenced on Illumina’s HiSeq X-ten platform that generated 2 × 150 bp of paired-end raw reads.

Analysis of TRACE-seq data

Raw sequencing reads were subjected to Trim_galore (http://www.bioinformatics.babraham.ac.uk/projects/trim_galore/) software (v0.6.7) for quality control and adapter trimming. Trimmed reads were downsampled to 30 Mb using seqtk. Then, the cleaned reads were mapped to the human genome (hg38, NCBI RefSeq) using STAR49 (v2.7.10b) with default parameters. Mapped reads were filtered by samtools50 (v1.14). The gene counts were quantified by HTSeq51 (v1.14), and genes with low biological repeatability (log2 fold change (replication 1/replication 2) > 1) were discarded. The gene expression level was quantified by FPKM.

Regression analysis on the housekeeping genes52,53 of the vector control and RESTART v3 groups was performed and obtained corresponding linear regression equations. Then, the coefficient relationship of actual counts and theoretical counts (calculated based on the linear regression equations) of global mRNA in RESTART v3-treated groups was analyzed.

Analysis of tRNA-seq data

Raw sequencing reads were subjected to Trim_galore (http://www.bioinformatics.babraham.ac.uk/projects/trim_galore/) software (v0.6.6) for quality control and adapter trimming. The first ten nucleotide random barcode at the 5′ end was removed by umi_tools54 (v1.0.0). Cleaned reads were mapped to the tRNA reference (hg38, NCBI RefSeq) using BWA-MEM55 (0.7.17-r1188) with default parameters. A maximum of three mismatches were allowed for the mapped reads. The tRNA counts were quantified by HTSeq51 (v1.14), and tRNAs with low biological repeatability (log2 fold change (replication 1/replication 2) > 1) were discarded. The tRNA expression level was quantified by FPKM.

Analysis of PRAISE data

For the analysis of PRAISE data, only read 2 was used for subsequent analysis. Trim_galore first subjected raw to adaptor trimming and filtering of low-quality reads. Duplicated reads were removed by SeqKit56 (v0.13.2). The key parameters were as follows: seqkit rmdup -s. umi_tools54 (v1.0.0) was used to remove the 8 bp UMI in the deduplication read. Six bases after the addition of UMI during library construction at the 5′ end of inserted sequences and the six bases at the 3′ end of inserted sequences were also removed. Then, the cleaned reads were downsampled to 40 Mb and were mapped to the reference transcriptome (hg38, NCBI RefSeq) using PRAISE tool32 (https://github.com/Zhe-jiang/PRAISE), and the pseudouridine signals as deletion rate in the transcriptome could be calculated. We identified putative off-target Ψ sites using the following approach: (1) more than 15 deletion reads cover each candidate site in restart(+) samples; (2) more than 100 reads cover each candidate site in restart(−) samples; (3) the deletion rate in restart(−) samples must be less than 1%; (4) the identified off-target Ψ sites must further meet the following criteria: the deletion rate difference in gctrl or RESTART v3 compared to mock groups must be >20%; and (5) for off-target Ψ sites, we applied the statistical test to each of them (contingency table test between restart(+) sample and restart(−) sample), and the P value between the two groups must be <0.000001.

Analysis of target-seq amplicon data

First, sequencing reads with the same UMI were grouped, and UMI groups with less than three reads were discarded. Then, PCR duplicates were removed by retaining the most consensus sequence in each UMI group. Adapter sequences were further trimmed from deduplicated reads with Trim_galore software (v0.6.7) with default parameters. The ten nucleotide UMIs were removed by umi_tools54 (v1.0.0). The cleaned reads were mapped to the targeted sequences using PRAISE tool32, and the deletion rate of target sites was calculated.

Immunoprecipitation and peptide identification by MS

HEK293T cells were transfected with FLAG-tagged reporter and RESTART v3 constructs. At 72 h post-transfection, cells were lysed, and the supernatant was collected after ultracentrifugation. Then, we enriched the FLAG-tagged protein from the supernatant using anti-FLAG M2-conjugated magnetic beads according to the manufacturer’s instructions, and the enriched protein was analyzed and purified by Coomassie staining. Subsequently, DTT reduction and IAM alkylation were performed before overnight digestion with porcine trypsin (sequencing grade modified; Pierce) at 37 °C. LC–MS/MS analysis was conducted using an Orbitrap Fusion Lumos mass spectrometer (Thermo Fisher Scientific), with data searched against a custom database including reporter-3 sequences with 20 different ‘X’ amino acids at PTC sites, and the UniProt Human database using Proteome Discoverer (Thermo Fisher Scientific). The relative abundance of each peptide (PSM > 1) was quantified by precursor ion intensity measurement using Proteome Discoverer 2.2 (Thermo Fisher Scientific), and the frequency of amino acid insertion at each PTC site was calculated based on their abundance.

Quantitative proteome analysis by MS

The HEK293T cell samples were lysed with cell lysis buffer (Thermo Fisher Scientific), and the supernatant was collected after centrifugation. The protein samples were quantified using the Pierce BCA Protein Assay Kit (Thermo Fisher Scientific) and verified by Coomassie Brilliant Blue gel. Then, the samples were diluted to a concentration of 1.5 μg μl−1 for mass spectrometry analysis, which was performed using an Orbitrap Fusion Lumos mass spectrometer (Thermo Fisher Scientific). The MS raw files were processed using Proteome Discoverer 2.2 software, and MS/MS spectra were searched by Sequest HT with Percolator validation against the UniProt database of human. Enzyme specificity was set as trypsin with a maximum of missed trypsin cleavage sites of 2. Peptides with PSM > 1 are considered valid and subjected to analysis. The precursor mass tolerance was set to 10 ppm, and the fragment ion mass tolerance was set to 0.02 Da. Carbamidomethylation (C) was considered a fixed modification, and oxidation (M) and acetylation (Protein N-term) were variable modifications. The false discovery rate applied at the peptide and protein levels was 1%.

Cytokine expression assay

HEK293T cells were seeded on 24-well plates (2 × 105 cells per well). When approximately 70–80% confluent, cells were transfected with 1.0 μg of RESTART v3 plasmid (target to CFTR-R553X). As a positive control, 1 μg of poly(I:C) (Invitrogen, TLRL-PICW) was transfected. After 48 h, cells were collected and subjected to RNA isolation (Thermo Fisher Scientific, 15596018). Then, the total RNAs were reverse-transcribed into cDNA via RT-PCR (Vazyme, R312-02), and the expressions of interferon-stimulated genes and pro-inflammatory genes were measured by qPCR (Takara Bio, RR820A). The sequences of the primers are listed in Supplementary Table 3.

Whole-cell patch clamp

Whole-cell patch clamp of 16HBEge cells was performed by ICE Bioscience Inc. The current was recorded with an EPC-10 amplifier, stored in PatchMaster (HEKA) software and digitized at 20 kHz. The membrane conductance was probed by stepping the membrane potential from a holding potential of −40 mV to membrane potentials −100 and +100 mV steps for 400 ms. Whole-cell current responses were measured in response to 40 µM 8-CPT cAMP, 10 µM VX-770 and 10 µM inhibitor-172. The pipettes had resistances between 2 and 5 MΩ when filled with pipette solution and the seal resistance exceeded 1 GΩ. The pipette solution contained 145 mM NMDG+-Cl, 1 mM MgCl2, 2 mM EGTA, 5 mM ATP and 10 mM HEPES. The bath solution was 150 mM Tris–HCl (pH 7.4), 1 mM MgCl2, 2.5 mM CaCl2 and 5 mM glucose. Current recording and analysis were performed with PatchMaster (HEKA) software and analyzed with IGOR software and GraphPad Prism 8 software.

GAG assay

The GAG content of MEFs was measured using the Blyscan Sulfated GAG Assay (Biocolor, CLRB1500). Here, 3 × 105 cells were digested with 500 µl of papain extraction reagent (Sigma-Aldrich, P3125) at 65 °C for 3 h, and supernatant GAG content was assayed according to the manufacturer’s protocol. An equal number of cells were lysed using M-Per Protein Reagent (Thermo Fisher Scientific, 78501) containing a protease inhibitor cocktail (Roche, 11873580001), and the total protein concentration in each lysate was determined using the Super-Bradford Protein Assay Kit (CoWin Biosciences, CW0013); the data are expressed as milligrams of GAG per milligram of total protein.

IDUA catalytic activity assay

Gathered cell pellets (3 × 105 cells) were resuspended and lysed in 50 μl Mammalian Protein Extraction Reagent (Pierce, P178501) containing a protease inhibitor cocktail (Roche, 11873580001) on ice for 1 h. Then, cell lysate containing no more than 80 µg of total protein was incubated in a 100-µl reaction containing 0.12 mM of 4-methyl-umbelliferyl-α-l-iduronide (Cayman, 2A-19543-500) and 0.42 mg ml1 of D-saccharic acid 1,4-lactone monohydrate (a β-glucuronidase inhibitor; Sigma-Aldrich, S0375) in 130 mM sodium formate buffer (pH 3.5). The reaction was incubated for 48 h at 37 °C and then subsequently quenched with 1 ml of glycine buffer (pH 10.8). The fluorescence of released 4MU (excitation wavelength, 365 nm; emission wavelength, 450 nm) was detected using a fluorescence plate reader (BioTek) and compared against a standard curve generated using 4MU (Sigma-Aldrich, M1381). The total protein concentration in each lysate was determined using the Super-Bradford Protein Assay Kit (CoWin Biosciences, CW0013). Specific activity was calculated as picomoles of 4MU released per milligram of protein per hour.

NMD assay

Here 16HBEge cells (G551D, untreated R553X and R553X treated with RESTART v2 or RESTART v3) and MEFs (WT, untreated W392X and W392X treated with RESTART v2 or RESTART v3) were collected and subjected to RNA isolation (Thermo Fisher Scientific, 15596018). Then, the total RNAs were reverse-transcribed into cDNA via RT-PCR (Vazyme, R312-02), and the expression of CFTR and mIDUA were measured by qPCR (Takara Bio, RR820A). The sequences of the primers are listed in Supplementary Table 3.

Reporting summary

Further information on research design is available in the Nature Portfolio Reporting Summary linked to this article.