Search
Close this search box.

Micropillar arrays, wide window acquisition and AI-based data analysis improve comprehensiveness in multiple proteomic applications – Nature Communications

Sample preparation for column benchmarking and WWA optimization studies

For initial benchmarking comparing packed columns with µPAC columns, QC4Life Reference standard (CS302403, Promega) was used that consists of LC-MS/MS Peptide Reference Mix (V7491, Promega) in a protein digest of K562 cells (V6951, Promega) diluted to 12.5 ng/5uL with 0.1% TFA.

Triple proteome mixes were made from commercial HeLa (H) (Thermo Scientific, Pierce™ HeLa Protein Digest Standard, 88328), yeast (Y) (Promega, MS Compatible Yeast Protein Extract, Digest, Saccharomyces cerevisiae, 100ug, V7461) and E. coli digests (E) (Waters, MassPREP E. coli Digest Standard, 186003196) combined at a ratio of H:Y:E = 8:1:1 in 0.1% TFA.

Pure HeLa digest samples were prepared from the same HeLa digest as mentioned for the triple proteome mix, which was diluted using 0.1% TFA to reach concentrations of 1 ng/uL for 1 ng injections, 10 ng/uL for 10 ng injections, 200 ng/uL for 100 and 200 ng injections and 800 ng/uL for 400 and 800 ng injections, respectively. To mimic single cell level injections, HeLa digest was diluted to 250 pg/uL in 0.1% TFA including 5% DMSO, and 1uL of this mix was used for injection.

Samples were prepared in glass autosampler vials (Fisherbrand™ 9 mm Short Thread TPX Vial with integrated Glass Micro-Insert; Cat. No. 11515924). All liquid handling was done as fast as possible without unnecessary time gaps aiming to minimize sample adsorption on any surfaces.

Cultivation of HeLa cells for single cell analysis

Human HeLa cells (ATCC, CCL2) were cultured at 37 °C in a humidified atmosphere at 5% CO2. HeLa cells were grown in Dulbecco’s Modified Eagle’s Medium (DMEM) supplemented with 10% FBS (10270, Fisher Scientific, USA), 1x penicillin-streptomycin (P0781-100ML, Sigma Aldrich, Israel) and 100X L-Glut 200 mM (250030-024, Thermo Scientific, Germany). Cells were grown to around 75% confluency before trypsinization with 0.05% Trypsin-EDTA (25300-054, Thermo Scientific, USA), followed by washing 3x with phosphate-buffered-saline (PBS). HeLa cells were resuspended in PBS at a density of 200 cells/μL for isolation with the CellenONE®.

Double proteome sample preparation

HeLa (H) (Thermo Scientific, Pierce™ HeLa Protein Digest Standard, 88328) and yeast (Y) (Promega, MS Compatible Yeast Protein Extract, Digest, Saccharomyces cerevisiae, 100 ug, V7461) were combined in 0.1% TFA at the following ratios in ng/μL: H:Y = 200:0, 150:50, 100:100, 50:150 and 200:0.

Isolation and sample preparation of single cell and 40 cell samples

HeLa cell isolation, lysis and digestion was performed within a fresh 384 well plate inside the CellenOne® as previously described25. Briefly, cells were sorted into well containing 1 µL of master mix containing 0.2% n-dodecyl-beta-maltoside (D4641-500MG, Sigma Aldrich, Germany), 100 mM tetraethylammonium bicarbonate 17902-(500 ML, Fluka Analytical, Switzerland), 3 ng/µL trypsin (Trypsin Gold, V5280, Promega, USA) and 0.01% enhancer (ProteaseMAX, V2071, Promega, USA). For single cell samples, cells were deposited into individual wells, while 40 cells were sorted into a single well for the 40 cell samples. Humidity and temperature were controlled at 15 °C and 60% during cell sorting. Only HeLa cells with at 18–25 μm diameter and a maximum elongation of 1.5 were isolated. For cell lysis and protein digestion the temperature was increased to 50 °C and the humidity to 85% to limit evaporation. Lysis and digestion were carried out for 2 h at 50 °C at 85% relative humidity inside the instrument. Samples were kept hydrated every 15 min by automated addition of 500 nL water to each well. After 30 min of incubation, additional 500 nL of 3 ng/μL trypsin were added replacing one hydration step. After lysis and digestion, 3.5 μL of 0.1% TFA with 5% DMSO were added to the respective wells for quenching and storage. Samples within the 384 well plates were stored at −70 °C. For the LC-MS/MS analysis, samples were directly injected from the 384 well plate.

Generation of FLAG tagged Smarca5 cell line

For endogenous tagging of Smarca5, WT mouse ES cells (HA36CB1) grown on a 10 cm plate were transfected with sgRNA/Cas9 ribonucleoprotein complex (sg RNA sequence: TTTGTCTTATAATCACTAAC) and 15 µg of repair plasmid carrying a GFP-3XFLAG tag sequence flanked on both sides by 500 bp of Smarca5 stop codon adjacent homology sequence. For assembling sgRNA/Cas9 ribonucleoprotein complex, 12 ug of sgRNA for Smarca5 was incubated with 5 ug of Cas9 protein in cleavage buffer for 5 min at RT. To transfect sgRNA/Cas9 ribonucleoprotein complex into mouse ES cells, electroporation was carried out following the instructions of the Mouse Embryonic Stem Cell Nucleofector Kit from Lonza (VPH-1001). After 2 days of recovery, GFP expressing cells were FACS sorted (see Supplementary Fig. 7) and seeded for clone picking on 15 cm plate. The clones were individually picked and expanded. Endogenous FLAG tagging of one allele (heterozygous) of smarca5 was confirmed by genotyping and western analysis.

Smarca5 Co-Immunoprecipitation

Mouse ES cells were grown on 15 cm plates until confluency. Cells were harvested and washed with 1 × PBS. Then, cells were resuspended in buffer 1 (10 mM Tris-HCl pH 7.5, 2 mM MgCl2, 3 mM CaCl2, Protease inhibitors (Roche)) and incubated for 20 min at 4 °C. After centrifugation, cells were resuspended in buffer 2 (10 mM Tris-HCl pH 7.5, 2 mM MgCl2, 3 mM CaCl2, Protease inhibitors (Roche), 0.5% IGEPAL CA-630, 10% glycerol) and incubated for 10 min at 4 °C. After this, cells were again centrifuged and nuclei were resuspended in buffer 3 (50 mM HEPES-KOH pH 7.3, 200 mM KCl, 3.2 mM MgCl2, 0,25% Triton, 0.25% NP-40, 0.1% Na-deoxycholate, 1 mM DDT, Protease inhibitors (Roche). 4 µl of benzonase was added to the nuclei suspension and was incubated for 1 h at 4 °C. The resulting nuclear lysate was cleared by centrifugation. For the Smarca5 IP, WT and Smarca5-Flag were added to magnetic anti FLAG M2 beads (Merck, Sigma-Aldrich, M8823) and incubated at 4 °C for 2 h. Beads were subsequently washed four times with buffer4 (50 mM HEPES-KOH pH 7.3, 200 mM KCl, 3.2 mM MgCl2, 0,25% Triton, 0.25% NP-40, 0.1% Na-deoxycholate, 1 mM DDT) and four times with Tris buffer (20 mM Tris-HCl pH 7.5, 137 mM NaCl).

On bead digest of Smarca5 samples

Frozen magnetic beads were thawed, 20 μL of 100 mM ammonium bicarbonate (Merck, Sigma-Aldrich, 09830-1KG) as well as 600 ng of LysC (Wako Chemicals, 129-02541) added and incubated for 4 h at 37 °C at 1200 rpm shaking. Supernatant was aspirated, transferred and tris-(2-carboxyethyl)-phosphin (TCEP, Merck, Sigma-Aldrich, 646547-10X1ML) added up to 1 mM and cysteine reduction performed for 30 min at 60 °C. Reversible blockage of cysteines was performed with S-methyl methanethiosulfonate (MMTS, Merck, Sigma-Aldrich, 64306-1 ML) at 4 mM for 30 min at room temperature. Trypsin digestion was performed overnight with 600 ng trypsin (Promega, V5280) at 37 °C without shaking. Digestion was quenched by addition of 10 μL 10% trifluoroacetic acid (TFA, Thermo Scientific, VC296817).

Liquid chromatography (LC) and ionization parameters for column benchmarking and WWA optimization studies

All samples were analyzed using a Vanquish Neo UHPLC operated in direct injection mode and coupled to the Orbitrap Exploris 480 mass spectrometer equipped with a FAIMS Pro interface (ThermoFisher Scientific). Analyte separation was performed using prototype versions of either the 5.5 cm High-Throughput µPAC Neo HPLC Column, the 50 cm µPAC Neo HPLC Column or the 110 cm µPAC Neo HPLC Column (all Thermo Fisher) with column volumes of 1.5 µL, 1.5 µL and 4.5 µL, respectively. For benchmarking, classical packed bed columns were used: nanoEase M/Z Peptide CSH C18 Column (130 Å, 1.7 μm, 75 μm X 250 mm, Waters, Germany), PepMap C18 (500 mm × 75 μm ID, 2 μm, 100 Å, Thermo Fisher Scientific) and Aurora Elite G3 (150 mm × 75 µm, 1.7 µm, IonOpticks, Australia). All columns were operated at 50 °C and connected to an EASY-Spray™ bullet emitter (10 µm ID, ES993; Thermo Fisher Scientific) except the Aurora column that already includes an emitter. An electrospray voltage of 2.4 kV was applied at the integrated liquid junction of the EASY-Spray™ emitter for all columns except the Aurora, for which 2.3 kV were used. To avoid electric current from affecting the upstream separation column, a stainless steel 50 µm internal bore reducing union (VICI; C360RU.5S62) was electrically connected to the grounding pin at the pump module for the µPAC columns.

Peptides were separated using gradients ranging from 5 min to 120 min ramping time as detailed in Supplementary Data 1.

MS Acquisition for column benchmarking and WWA optimization studies

MS acquisition was performed in data-dependent mode, using a full scan with m/z range 380–1200, orbitrap resolution of 60,000, target value 100%, and maximum injection time set to auto. 1 to 4 FAIMS compensation voltages were combined in a single run as detailed in Supplementary Data 6 using a total cycle time of 3 s. The precursor intensity threshold was set to 1e4. Dynamic exclusion duration was based on the length of the LC gradient and is detailed in Supplementary Data 6.

Fragmentation by HCD was done using a normalized collision energy of 30%, and MS-MS spectra were acquired at a resolution of 15,000. Precursors were isolated using a m/z window of 4 for WWA and 1 for normal DDA, respectively, if not stated otherwise.

Data analysis for column benchmarking and WWA optimization studies

MS/MS spectra from raw data were imported to Proteome Discoverer (PD) (version 3.0.0.757, Thermo Scientific). Database search was performed using MS Amanda21,22 (version 2.5.0.16129) or CHIMERYS as indicated against a combined database of human (uniprot reference, version 2022-03-04, 20,509 entries), yeast (uniprot reference, version 2015-01-13, 4877 entries) and E. coli (uniprot reference, version 2021-11-19, 4350 entries) as well as common contaminants (PD_Contaminants_IGGs_v17_tagsremoved, 344 entries). For HeLa samples, yeast and E. coli databases were removed for searches. Trypsin was specified as proteolytic enzyme, cleaving after lysine (K) and arginine I except when followed by proline (P) and up to two missed cleavages were allowed. Fragment mass tolerance was limited to 20 ppm and carbamidomethylation of cysteine (C) was set as a fixed modification and oxidation of methionine (M) as a variable modification. Identified spectra were rescored using Percolator and results were filtered for 1% FDR on peptide and protein level. Abundance of identified peptides was determined by label-free quantification (LFQ) using IMP-apQuant without MBR43.

LC-MS/MS analysis of single and 40 cell samples

All single and 40 cell samples were analyzed using a Vanquish Neo UHPLC operated in trap-and-elute mode and coupled to the Orbitrap Exploris 480 mass spectrometer equipped with a FAIMS Pro interface (ThermoFisher Scientific). Peptides were loaded on a trapping column (Thermo Fisher Scientific, PepMap C18, 5 mm × 300 μm i.d., 5 μm particles, 100 Å pore size) using 0.1% TFA as the mobile phase. Peptides were eluted from the trapping column onto a prototype versions of the 5.5 cm High-Throughput µPAC Neo HPLC Column (Thermo Fisher Scientific) using a flow rate of 250 nl/min with a gradient length of 20 min. The gradient started with mobile phases of 99% A (water:formic acid, 99.9:0.1 v/v) and 2% B (water:acetonitrile:formic acid, 19.92:80:0.08 v/v/v), increasing first to 25% B in 14.5 min before ramping up to 40% B in 5 min, followed by a gradient over 5 min to 95% B, that was held for 5 min and decreasing in 0.1 min back to 99% A and 1% B for equilibration at 50 °C.

The Orbitrap Exploris 480 mass spectrometer was operated in the data-dependent mode with the FAIMS Pro using a single compensation voltage of −50 V. A full scan (m/z range of 375–1200, MS1 resolution of 120,000, normalized AGC Target of 300%) was followed by up to 10 MS/MS scans of the most abundant ions. MS/MS spectra were acquired using a normalized collision energy of 30%, an isolation width of m/z 1 for DDA runs and m/z 12 for WWA runs and a resolution of 60,000 with a normalized AGC target of 75%. Precursor ions selected for fragmentation (exclude charge state 1, 6, 7, 8 and >8) were placed on a dynamic exclusion list for 120 s. Additionally, the intensity threshold was set to a minimum intensity of 5 × 103.

Single HeLa cell data analysis

MS/MS spectra from raw data were imported to Proteome Discoverer (PD) (version 3.0.0.757, Thermo Scientific). Database search was performed using CHIMERYS as indicated against a human database (uniprot reference, version 2022-03-04, 20,509 entries) as well as common contaminants (PD_Contaminants_IGGs_v17_tagsremoved, 344 entries). Trypsin was specified as proteolytic enzyme, cleaving after lysine (K) and arginine (R) except when followed by proline (P) and up to two missed cleavages were allowed. Carbamidomethylation of cysteine (C) was set as a fixed modification and oxidation of methionine (M) as a variable modification. Identified spectra were rescored using Percolator and results were filtered for 1% FDR on peptide and protein level. Abundance of identified peptides was determined by label-free quantification (LFQ) using IMP-apQuant without MBR43.

LC-MS analysis of immunoprecipitation samples

The nano HPLC system used was an UltiMate 3000 RSLC nano system coupled to a Orbitrap Exploris 480 mass spectrometer, equipped with an EASY-spray ion source (Thermo Fisher Scientific) and a JailBreak 1.0 adaptor insert as the spray emitter (Phoenix S&T) as well as a FAIMS Pro device (Thermo Scientific). Peptides were loaded on a trapping column (Thermo Fisher Scientific, PepMap C18, 5 mm × 300 μm i.d., 5 μm particles, 100 Å pore size) at a flow rate of 25 μl/min using 0.1% TFA as the mobile phase. 10 min after sample injection, the trapping column was switched in line with the analytical column and peptides were eluted from the trapping column onto the analytical column using a flow rate of 230 nl/min and a binary 2 h gradient was employed. MS acquisition was started 10 min after switching the trap column in line with the analytical column for a total MS acquisition time of 140 min, a total run length of 165 min and 120 min active gradient. The analytical column was either a classical 50 cm packed bed column (Thermo Fisher Scientific, PepMap C18, 500 mm × 75 μm i.d., 2 μm, 100 Å) or a prototype version of the 110 cm µPAC Neo HPLC Column (Thermo Fisher Scientific, micropillar array column, C18) The gradient started with mobile phases of 98% A (water:formic acid, 99.9:0.1 v/v) and 2% B (water:acetonitrile:formic acid, 19.92:80:0.08 v/v/v), increasing to 35% B over the next 120 min, followed by a gradient over 5 min to 95% B, held for 5 min and decreasing over 2 min back to gradient 98% A and 2% B for equilibration at 30 °C. The trapping column was switched out of line from the analytical column 3 min after reaching 2% B again, and equilibration at 2% B was continued until the total run time of 165 min was reached.

The Orbitrap Exploris 480 mass spectrometer was operated in the data-dependent mode with the FAIMS Pro using three different compensation voltages at −45, −60 and −75 in an alternating fashion switching between compensating voltages every 0.9 s. A full scan (m/z range of 350–1200, MS1 resolution of 60,000, normalized AGC Target of 100%) was followed by MS/MS scans of the most abundant ions until the cycle time of 0.9 s was reached. MS/MS spectra were acquired using a normalized collision energy of 30%, an isolation width of m/z 1,  a resolution of 30,000 and a normalized AGC target of 200%. Precursor ions selected for fragmentation (exclude charge state 1, 7, 8 and >8) were placed on a dynamic exclusion list for 45 s. Additionally, the intensity threshold was set to a minimum intensity of 2.5 × 104.

Data analysis of immunoprecipitation raw data

For peptide identification, RAW files were loaded into Proteome Discoverer (v.3.0.0.757, Thermo Scientific). All the created MS/MS spectra were searched either using MSAmanda v.2.021,22 or CHIMERYS (MSAID GmbH, Germany). For the processing step, the RAW files were searched against the mouse Uniprot reference database (2022-03-04; 21,962 sequences and 11,728,099 residues) and an in-house contaminant database (PD-Contaminants_IGGs_v17_tagsremoved; 344 sequences and 142,046 residues).

The following search parameters were used for MS Amanda 2.0: the peptide mass tolerance was set to ±5 ppm and the fragment mass tolerance to 10 ppm; the maximal number of missed cleavages was set to 2; and the result was filtered to 1% false discovery rate (FDR) on the protein level using the Percolator algorithm integrated in Thermo Proteome Discoverer. Beta-methylthiolation on cysteines was set as fixed modification, whereas methionine oxidation was set as variable modification.

For CHIMERYS the following search parameters were used: as prediction model inferys_2.1_fragmentation was chosen using trypsin with a maximum of two missed cleavages. Peptide length was restricted to 7–30 amino acids, a maximum of three modifications per peptide and a charge state of 2–4. Fragment mass tolerance was set to 20 ppm. Methionine oxidation was set as variable modification, while cysteine carbamidomethylation was predefined by the software as fixed modification and could not be unselected even though the samples had been treated with methyl methanethiosulfonate (MMTS) to reversibly sulfenylate cysteine introducing beta-methylthiolation. However, since only around 8% of the peptides identified with MS Amanda 2.0 contained cysteines, this incorrect parameter was considered negligible in the course of this analysis, while using the correct fixed modification would have surely resulted in even better results for all CHIMERYS searches.

Peptide areas were quantified using IMP-apQuant43 using only PSM of high confidence level, with a minimum sequence length of 7 and a minimum score of 150 for MS Amanda 2.0 and −99 for the CHIMERYS Ion Coefficient and match-between-runs and RT correction were disabled. Retention time tolerance was set to 0.5, missing peaks to 2 and FWHM interpolation was enabled, and number of checked peaks set to 5. The results were filtered to 1% FDR on the protein level using the Percolator algorithm integrated in Thermo Proteome Discoverer. Statistical significance of differentially abundant peptides and proteins between different conditions was determined using a limma test32. Statistical significance was calculated for both 1% and 5% FDR as described by ref. 44

Reporting summary

Further information on research design is available in the Nature Portfolio Reporting Summary linked to this article.