Lysosomal “TRAP”: a neotype modality for clearance of viruses and variants

Study approval

The mouse study was performed in strict accordance with the Regulations for the Care and Use of Laboratory Animals and Guideline for Ethical Review of Animal (China, GB/T 35892-2018). The animal protocol was reviewed and approved by the Animal Ethics Committee of the Institute of Process Engineering (approval ID: IPEAECA2021013).

The hamster study was performed in strict accordance with the Regulations for the Care and Use of Laboratory Animals and Guideline for Ethical Review of Animal (China, GB/T 35892-2018). The animal protocol was approved and conducted in accordance with the institutional guidelines of the Peking Union Medical College Animal Care and Use Committee (approval ID: DWSP202207004).

The human studies were approved by the Biomedical Research Ethics Committee of Peking University First Hospital (approval ID: No.2018-135 and No.2021-486) and written informed consent was obtained from health donor.

Reagents and materials

Anti-human ACE2 antibody (ab272500), Anti-LAMP-2 antibody (ab25631), Anti-LAMP-1 antibody (ab24170), Anti-S1 antibody (ab281311), Anti-AQP5 antibody (ab92320), Anti-SFTPC antibody (ab90716), Anti-N protein of H1N1 antibodies (ab104870), Goat anti-rabbit secondary antibody-Alexa Fluor® 488 (ab150077), Rabbit anti-goat secondary antibody-Alexa Fluor® 647 Abcam (ab150083), Anti-HIV1 p55-p24-p17 antibody (ab309159), Anti-human ACE2 antibody (ab108252), Anti-LAMP-2 antibody (ab19947), Anti-S2 antibody (ab283913), and Anti-HA antibody (ab281948) were purchased from Abcam. Alexa Fluor® 647 anti-mouse MHC-I Antibody (111512), Alexa Fluor® 488 anti-mouse MHC-II Antibody (114407), FITC anti-mouse/human CD11b Antibody (101206), PE anti-mouse F4/80 Antibody (111604), Brilliant Violet 510™ anti-mouse Ly-6G Antibody (127633), and Alexa Fluor® 700 anti-mouse Ly-6C Antibody (128024) were purchased from Biolegend. Human ACE2 and RBD antibody were purchased from Sino Biological. EIDD-2801 was purchased from MedChemExpress. Cytochalasin B, puromycin, FITC, sodium fluorescein, Agarose (Low melting gel) and streptavidin-FITC was purchased from Solarbio Life Sciences. Lysosome Extraction Kit was purchased from Bestbio. Enzyme-linked immunosorbent assay (ELISA) kits for cytokines (IFN-γ, IL-6, and TNF), Acid Protease Activity Detection Kit were purchased from Solarbio Life Sciences. RNAeasy™ Viral RNA Isolation Kit with Spin Column, ACE2 Activity Fluorometric Assay Kit, and BeyoFast™ SYBR Green One-Step qRT-PCR Kit were purchased from Beyotime Biotechnology. One Step PrimeScript q-PCR Kit was purchased from TCI. All primers were purchased from Sangon Biotechnology. 1,1’-Dioctadecyl-3,3,3’,3’-Tetramethylindodicarbocyanine,4-Chlorobenzenesulfonate Salt (DiD), Cyanine7 NHS ester (Cy5-SE) and Cyanine5 NHS ester (Cy5-SE) were purchased from FANBO biochemicals. OrganoPro^TM Huamn Lung Organoids Culture Kit was purchased from K2ONCOLOGY. Matrigel^TM was purchased from Coring/BD. Penicillin-Streptomycin, Trypsin-EDTA, and Dulbecco’s modified Eagle medium (DMEM) high supplemented were purchased from Biological Industries. Pseudotype SARS-COV-2 (wild-type) were purchased from Langmiao Biotechnology.

Cell lines

MDCK (catalog no. CL-0154) was purchased from Procell Life Science&Technology Co., Ltd (Wuhan, China). ACE2-OE HEK-293T (catalog no. BFN60700110A) was purchased from Shanghai Qingqi technology Co., Ltd (Shanghai, China). ACE2-OE HEK293T cells were cultured in Dulbecco’s modified Eagle medium (DMEM, high glucose; BI) supplemented with 100 U/mL of Penicillin-Streptomycin solution, and 10% fetal bovine serum (FBS, GIBCO) in a 5% CO₂ environment at 37 °C. Mice peritoneal macrophages were harvested from stimulated female C57BL/6 mice according to a typical protocol and cultured under standard conditions⁴⁵. Briefly, mouse peritoneal macrophages were collected from 8-10 week-old C57BL/6 mice by peritoneal lavage with 10 ml of phosphate-buffered saline, centrifuged at 500 g for 10 min, and cultured in RPMI 1640 medium containing 10% (v/v) fetal bovine serum (FBS), 2 mmol L-glutamine, 100 U/mL penicillin, and 100 g/mL streptomycin. Hamster peritoneal macrophages were harvested from female hamsters (8 week-old) with same above-mentioned procedure of mice, excepting for 50 ml of PBS for the peritoneal lavage. Human macrophages were generated from the peripheral blood mononuclear cells (PBMCs) by induced differentiation⁴⁶. Briefly, PBMCs were isolated from peripheral blood of HLA-A2+ health donor by Ficoll-Paque density gradient separation, and then CD14+ cells were isolated from PBMCs using CD14 Microbeads and cultured in the RPMI-1640 medium containing 20% human serum and 1% penicillin/streptomycin in the presence of recombinant GM-CSF (50 ng/mL).

Animals

Female C57BL/6 mice (8 weeks old) were purchased from Beijing Vital River Laboratories and female human ACE2 C57BL/6 mice (8 weeks old) were purchased from Gempharmatech Co.,Ltd. The mice were housed in an environmentally controlled room (23 °C, with 55 ± 5% humidity and under a 12 h–12 h light–dark cycle).

Female hamsters (8 weeks old) were purchased from Beijing Vital River Laboratories and were housed on the Animal Center of the Peking Union Medical College for SARS-CoV-2 study. The hamsters were housed in an environmentally controlled room (23 °C, with 55 ± 5% humidity and under a 12 h–12 h light–dark cycle). All animals were randomly divided into various groups for subsequent experiments.

Virus

In the study, ten pseudotyped SARS-CoV-2 were utilized including wild-type pseudotyped SARS-CoV-2 and nine pseudotyped SARS-CoV-2 variants. The wild-type pseudotyped SARS-CoV-2 was purchased from Langmiao Biotechnology, and was prepared as lentiviral vector by using a pseudotyped virus packaging system of human immunodeficiency virus (HIV) with expressing the S protein at the capsid membrane surface. Nine pseudotyped SARS-CoV-2 variants were gifted from Professor Youchun Wang of Institute for Biological Product Control, National Institutes for Food and Drug Control (NIFDC), and WHO Collaborating Center for Standardization and Evaluation of Biologicals, Beijing, China. These variants with S protein mutations were prepared using a pseudotyped virus packaging system of vesicular stomatitis virus (VSV)⁴⁷, including the D614G strain, three variants of interest (VOI) and five variants of concern (VOC).

In the experiments of trapping authentic SARS-CoV-2 in vitro and clearing authentic SARS-CoV-2 on human lung organoid model, wild-type authentic SARS-CoV-2 (SARS-CoV-2/human/CHN/CN1/2020, GenBank number MT407649.1) and SARS-CoV-2 Omicron variants were utilized following the institutional biosafety guidelines of biosafety level 3 (BSL3) laboratory by the Sinovac Life Sciences Co., Ltd. In the experiment of clearing authentic SARS-CoV-2 on hamster model, wild-type strain (SARS-CoV-2-KMS1/2020/GenBank accession number: MT226610.1) and Omicron strain (CCPM-B-V-049-2112-18) were utilized following the institutional biosafety guidelines of BSL3 laboratory by the Institute of Medical Biology, Peking Union Medical College, Chinese Academy of Medical Sciences, Kunming, China.

Preparation of lysoTRAP

Activation of primary macrophages

Primary macrophages (mouse-derived, hamster-derived and human-derived) were cultured in 1640 medium containing 1 ng/mL lipopolysaccharide (LPS) for about 48 h, resulting in the activation of primary macrophages.

Isolation of lysosomes

The preliminary lysosomes were obtained from above primary macrophages by using the Lysosome Extraction Kit (Bestbio) according to the manufacturer’s instructions. In brief, the activated primary macrophages were re-suspended in reagent A at 4 °C for 10 min, followed by a homogenization to destroy cell structure. Then, the homogenate was successively centrifuged at 1000 g for 5 min, 3000 g for 10 min, 5000 g for 10 min and 20,000 g for 20 min to isolate lysosomes. The lysosome precipitate was re-suspended in reagent B and was further purified by centrifugation. Then, we further purified lysosomes with immune magnetic beads via immunization method, in which the obtained lysosomes were successively processed with capture of LAMP-1 Dynabeads (anchored with LAMP-1 antibody (ab24170, Abcam), adsorption under magnetic field, and elution via LAMP-1 peptide (ab25744, Abcam) for the purity of lysosomes.

Modification of lysosome

The lysosomes were mixed with DSPE-PEG-NTA-Ni at 37 °C for 1 h for anchoring the NTA-Ni. Then the mixture was centrifuged to remove free DSPE-PEG-NTA-Ni and ACE2-His tag fusion protein was added into the lysosome solution. After 1 h incubation, the free ACE2 was removed by centrifuging and lysosomes modified with ACE2 protein (lysoTRAP) were obtained. The ACE2 protein utilized in the study was a commercial product and purchased from SinoBiological company (cat: 10108-H08H). This recombinant human ACE2 protein was produced by human HEK293T cells, in which the transferred DNA encoded extracellular domain of human ACE2 (Met1-Ser740) with a polyhistidine tag at the C-terminus.

Characterizations of the lysosomes with or without LPS stimulation

The morphology of lysosomes isolated from macrophages stimulated with or without LPS was observed using transmission electron microscope (TEM) (JSM-6700, JEOL, Japan). Protein concentration of these lysosomes was determined by Micro BCA Protein Assay Kit (PI23235, Thermo Scientific). For deep investigation, LC-MS based proteomics analysis was conducted by Q Exactive™ Hybrid Quadrupole-Orbitrap™ Mass Spectrometer with associated software (Thermo Proteome Discoverer, version 2.5.0.400) to analyze the hydrolase amount in the lysosomes with or without LPS stimulation. Specific steps were as follows

1. (1)

   Sample preparation. The lysosomes were obtained from macrophages with or without LPS stimulation by using the Lysosome Extraction Kit (Bestbio) according to the manufacturer’s instructions. The proteins of each sample were extracted from lysosomes by protein extraction solution containing 8 M urea.

2. (2)

   Protein Processing. A 100 µg aliquot of above extracted proteins was first subjected to reduction via incubating with 200 mM dithiothreitol (DTT) solution at 37 °C for 1 h. Then, protein samples were digested into small peptides by incubating with trypsin (trypsin: protein =1:50) at 37 °C overnight.

3. (3)

   LC-MS Analysis. LC-MS Analysis of above-obtained tryptic peptides was conducted on a quadrupole Orbitrapmass spectrometer (Orbitrap Exploris™ 480, Thermo Fisher Scientific, Bremen, Germany) coupled to an EASY nLC 1200 ultra-high-pressure system (Thermo Fisher Scientific) via a nano-electrospray ion source. Briefly, 500 ng of above-obtained tryptic peptides were loaded on a 25 cm column packed using ReproSil-Pur C18-AQ 1.9- µm silica beads and eluted over a 60 min gradient of Acetonitrile and Formic acid. Spectra were acquired with an Orbitrap Exploris™ 480 Mass Spectrometer (ThermoFisher Scientific) with FAIMS Pro™ Interface (ThermoFisher Scientific).

4. (4)

   Data analysis. All RAW files were analyzed using the Proteome Discoverer suite (version 2.4, Thermo Fisher Scientific). MS spectra were searched against the UniProtKB mouse proteome database to identify the peptides. Percolator was used to filter spectral matches and peptides with a false discovery rate (FDR) of less than 1%. After spectral assignment, identified peptides were assembled into proteins and were further filtered based on the combined probabilities of their constituent peptides to a final FDR of 1%.

5. (5)

   Quantitation and normalization. The amounts of each identified proteins were quantitated by the amount and intensity of corresponding peptides identified in LC-MS analysis. The same amounts of tryptic peptides applied in LC-MS analysis ensured the normalization between each sample in the proteomics.

Characterizations of lysoTRAP

The particle sizes and zeta potential of lysoTRAP were analyzed by Nanoparticle Tracking Analysis (NTA, Mastersizer 2000, Malvern Instruments Ltd, UK). The morphology of lysoTRAP was observed using TEM (JSM-6700, JEOL, Japan). To verify successful ACE2 anchorage on the surface of lysoTRAP, immunofluorescent staining was performed. LysoTRAP were successively labeled with ACE2 fluorescent antibody and LAMP-2 fluorescent antibody, and observed by using confocal laser scanning microscopy (CLSM, A1/SIM/STORM, Nikon, Japan). The amount of ACE2 molecule per lysoTRAP was determined by enzyme-linked immunosorbent assay (ELISA). In brief, 96-well plates (Corning) were coated with above unmodified ACE2 protein supernatant overnight at 4 °C in coating buffer, and blocked in 5% bovine serum albumin in PBS for 2 hours at 37 °C. Then the plates were successively incubated with 100 µL of rabbit anti-ACE2 with a 1:10000 dilution at 37 °C for 0.5 h, followed the incubation by HRP-conjugated goat anti-rabbit secondary antibody at 37 °C for 0.5 h. Plates were washed quintic with 1× PBS containing 0.05% Tween-20 (PBST) and pigmented with 3,3′,5,5′-tetramethytlbenzidine for 10 min at room temperature, and the reaction was stopped with 2 M H₂SO₄. The absorbance at 450 nm was measured by a microplate reader (Tecan Infinite M200). The enzymatic activities of ACE2, Cathepsin L, Cathepsin B. total protease and RNase in intact lysosome or lysoTRAP were detected by ACE2 Activity Fluorometric Assay Kit (P0139S, Beyotime, China), Cathepsin L Assay (ab270774, Abcam), Cathepsin B Assay (ab270772, Abcam), Acid Protease Activity Detection Kit (BC2280, Solarbio, China), and RNase Activity Fluorometric Assay Kit (P0347S, Beyotime, China), respectively. The acid environment in lysosomes was determined by a lysosomal acid indicator purchased from TongRen Chemical (L264, China). To obtain the lysates of lysosome and lysoTRAP, repetitive freeze-thawing was used to gently break the membrane of lysosome and lysoTRAP. The enzymatic activity of the Furin on the external surface of lysosomes or lysoTRAP was detected by Furin Protease Assay Kit (Bioscience, 78040). The lyophilized lysoTRAP was obtained by using freeze drying technique with the freeze-drying protective additives (50 mM trehalose and 100 mM mannitol).

Programmed performance of lysoTRAP in capturing, internalizing, and degrading pseudotyped SARS-CoV-2 virions in vitro

LysoTRAP capturing pseudotyped SARS-CoV-2 virions

To verify the specific capture performance of lysoTRAP to SARS-CoV-2 pseudotyped virus, quartz crystal microbalance (QCM) experiment was conducted according to a reported protocoll⁴⁸. Briefly, equivalent amounts of lysosomes, lysoTRAP, lysoTRAP+ACE2-Ab (lysoTRAP pretreated with ACE2 antibody), lysoTRAP+LAMP-2-Ab (lysoTRAP pretreated with LAPM-2 antibody) were respectively flowed out the Au chip, and the effluent was collected for NTA analysis, obtaining the accurate amount remained on chip. Then, the PBS was continuously pumped to balance the baseline, the effluent was also collected for NTA analysis, obtaining the accurate amount of lysosomal material on the chip. Of note, equivalent amounts of lysosomal material were retained on the chip between different groups. Next, pseudotyped SARS-CoV-2 virions or control virions (pseudotyped virions without S protein) were continuously flowed through the chip until the frequency curve reached a plateau. Finally, PBS flowed to remove any nonspecific binding. In this process, the collected electrical signals (mainly frequency) respond to weight changes on the chip. It should be noted that the captured virions could be further internalized by lysoTRAP, which would not induce the mass change on chips. Therefore, the weight change could be utilized to indicate the relative amounts of virions captured by lysoTRAP/lysosomes.

LysoTRAP internalizing pseudotyped SARS-CoV-2 virions

LysoTRAP and pseudotyped SARS-CoV-2 virions were incubated with Cyanine5 NHS ester (Cy5-SE) and BODIPY (lipophilic micro-molecule fluorescent dye with good stability under acidic condition, inserted into the phospholipid membrane) at 37 °C for 1 h, respectively, and purified to remove free Cy5-SE and BODIPY via ultrafiltration. Then, 10 μg Cy5-labeled lysoTRAP was mixed with 5 × 10⁸ TU BODIPY-labeled pseudotyped SARS-CoV-2 virions at a rate of 1:5 (lysoTRAP: pseudotyped virion) (total volume: 1 mL). Then, we captured the dynamic internalizing process about the signal from BODIPY-labeled pseudotyped virion into Cy5-labeled lysoTRAP in a real time via CLSM (A1/SIM/STORM, Nikon, Japan). To further verify the performance of internalizing the SARS-CoV-2 pseudotyped virions inside lysoTRAP, the lysoTRAP was incubated with pseudotyped virion at 37 °C for 1 h and observed by stimulated emission depletion microscopy (STED, SP8, Leica) and TEM (JSM-6700, JEOL, Japan).

To explore the internalization mechanism of SARS-CoV-2 by lysoTRAP, Fluorescence Resonance Energy Transfer (FRET) analysis was conducted. Briefly, lysosome or lysoTRAP lysosomal samples (naked lysosomes, lysoTRAP and lysoTRAP with Furin inhibitor (1 nM chloromethylketone)) were labeled by Cy7-SE (excitation/emission: 755/785 nm), and pseudotyped SARS-CoV-2 virions were labeled by Cy5.5 (excitation/emission: 673/715 nm). After the incubation of lysosomal samples with pseudotyped SARS-CoV-2 virions at 37 °C for 1 h, the emission intensity of each lysosomal sample group from 700 nm to 850 nm was detected under the 673 nm excitation. The S2 protein was detected by WB with an anti-SARS-CoV-2 spike glycoprotein S2 antibody (Abcam, ab283913).

LysoTRAP degrading pseudotyped SARS-CoV-2 virions

10 μg lysoTRAP was mixed with 5 × 10⁸ TU SARS-CoV-2 pseudotyped virions at a rate of 1:5 (lysoTRAP: pseudotyped virion) and incubated at 37 °C (total volume: 1 mL). At the point-in-time of 0, 1, 4, 12, and 24 h, the compound was homogenized with RIPA and virion protein could be isolated according to the manufacturer’s protocol (RIPA Lysis Buffer, P0013B, Beyotime). The protein levels of SARS-CoV-2 were determined by ELISA. Same procedures of above-mentioned ACE2 ELISA were applied. In brief, 96-well plates (Corning) were coated with above isolated protein, blocked in 5% bovine serum albumin, incubated with 100 µL of rabbit anti-P55 or anti-P24 and HRP-conjugated goat anti-rabbit secondary antibody pigmented with 3,3′,5,5′-tetramethytlbenzidine, suspended with H₂SO₄ and measured the absorbance by a microplate reader.

To verify lysoTRAP degrading SARS-CoV-2 pseudotyped virus in the RNA levels, the compound of lysoTRAP and SARS-CoV-2 pseudotyped virions was homogenized with Trizol, and virus RNA could be isolated according to the RNAeasy™ Viral RNA Isolation Kit with Spin Column (R0035L, Beyotime). SARS-CoV-2 viral RNA levels were measured by commercially available BeyoFastTM SYBR Green One-Step qRT-PCR Kit (D7268s, Beyotime) on a CFX96 real-time PCR detection system (Bio-Rad) with GFP and Luc primers, respectively (sequences (Sangon Biotech): GFP-F, CATGTACCACGAGTCCAAGTTCTACG; GFP-R, CTCCCAGTTGTCGGTCATCTTCTTC; Luc-F, TACACCTTCGTGACTTCCCATTTGC; Luc-R, CAATCCGGTACTGCCACTACTGTTC). The PCR conditions were as follows: 50 °C for 15 min (reverse transcription), 95 °C for 2 min (predegeneration), 42 cycles of 95 °C for 15 s, and 60 °C for 30 s (amplification). The mRNA levels were normalized according to the result at 0 h.

To further verify the degradation capacity of lysoTRAP to SARS-CoV-2 pseudotyped virions, we used Bafilomycin A1 to inhibit acid accumulation in the lysosomes before isolating lysosomes from cells, obtaining neutralized lysosome. After incubation with SARS-CoV-2 pseudotyped virus, the levels of viral protein and viral RNA were detected by above mentioned method. Meanwhile, the inhibitor complex, including leupeptin (10 nM), Pepstatin A (10 nM), E-64 (10 nM), and RNase inhibitor (10 nM), was introduced into lysoTRAP by electroporation. After incubation with SARS-CoV-2 pseudotyped virus, the levels of viral protein and viral RNA were detected by above mentioned method.

Pseudotyped virion infection assay

For the infection inhibition assay, ACE2-OE HEK-293T cells were seeded in 96-well plates (10,000 cells/well) and incubated at incubator for 1 d, and then treated with pseudotyped virus (5 × 10⁴ TU/well) and lysoTRAP (100 μg/mL) at the same time for 2 d. In the assay, the molecular amount of ACE protein in the free ACE2 group is equal to the molecular amount of ACE protein presented on the lysoTRAP surface and the amount of lysosome in the naked lysosome group is equal to the amount of lysoTRAP. For microscopy imaging, the nuclei were stained DAPI and imaged by CLSM (A1/SIM/STORM, Nikon, Japan). For flow cytometry analysis, the cells were collected and analyzed by flow cytometry (Beckman coulter, CytoFLEX).

We also obtained serval pseudotyped SARS-CoV-2 variants, which were gifted from Professor Youchun Wang of Institute for Biological Product Control, National Institutes for Food and Drug Control (NIFDC), and WHO Collaborating Center for Standardization and Evaluation of Biologicals, Beijing, China. According to a reported method⁴⁷, these variants expressed a luciferase reporter gene and the virus infection were determined via the luminescence of each well, which was detected by multimode microplate reader (EnVision, PerkinElmer).

In vivo biodistribution of lysoTRAP

The biodistribution of lysoTRAP in mice

C57BL/6 mice were randomly divided into two groups (3 mice per group) and administrated with Cy7-labeled lysoTRAP (100 μg) via pulmonary inhalation and i.v. injection. At different time intervals, fluorescence imaging of mice was taken using an in vivo imaging system (FX Pro, 624 Kodak) with the Carestream MI software (v.5.0.7 version) with a 670 nm excitation wavelength and a 720 nm filter to collect the lysoTRAP signals. In the ex vivo imaging experiments, the mice were euthanized to extract organs following to capture again at 9 h post-administration. It should be noted that Cy7-SE was linked to the -NH2 of membrane proteins on lysoTRAP by a chemical bond. Considering the stable conjugation, it was reasonable to envision that Cy7-SE held a stable association on lysoTRAP in vivo and thus could adequately indicate lysoTRAP in tissues.

The inhalation treatment was conducted via liquid aerosol devices (Huironghe Company, Beijing, China), including a Micro Sprayer, small laryngoscope for mouse and nylon band, which was specifically design to fit the demand of mouse inhalation⁴⁹. In brief, mice were anesthetized by the intraperitoneal injection of 500 mg/kg body weight avertin and then supported by a nylon band under its upper incisors and restrained on a slanted board (60 ^o from the horizontal direction). The tracheal opening was visualized by inserting a laryngoscope; the Micro Sprayer, which is capable of ejecting liquid particles with a particle size of 5.02 ± 0.35 mm, was inserted 25 mm from the larynx (near the tracheal bifurcation) of the mouse. At each inhalation, 50 μl of lysoTRAP solutions or other was aerosolized into the lungs by depressing the Micro-Sprayer plunger with a constant force.

The biodistribution of lysoTRAP in lungs

To verify whether lysoTRAP uniformly distribute over the whole lung, light-sheet imaging was performed. C57BL/6 mice were administrated with Cy5-labeled lysoTRAP (100 μg) via pulmonary inhalation and then euthanized to extract lungs. Here, considering the commercialized light-sheet microscopy was equipped with the laser for the excitation of Cy5 rather than Cy7, we switched the dye from Cy7 to Cy5. The collected lungs were processed with Tissue-Clearing Reagent CUBIC (TCI) for tissue-clearing according to the manufacturer’s instructions, which followed the fluorescence staining of lung trachea by streptavidin-FITC. In the end, the lungs were immersed in CUBIC-R+ reagent and captured by light-sheet microscopy (Z.1, Zeiss, Germany). Image reconstructions were generated using Imaris v9.0 software.

The biodistribution of lysoTRAP in lung cells

C57BL/6 mice were administrated with Cy5-labeled lysoTRAP (100 μg) via pulmonary inhalation. The collected lungs fixed with 4% paraformaldehyde, dehydrated with 30% sucrose solution, embedded in OCT tissue compound and finally sectioned into 10 μm lung slides by freezing microtome (CM1950, Leica, Germany). To verify whether the ultimate destination of lysoTRAP were macrophages, the slides were stained with anti-F4/80 (rabbit), corresponding fluorescent secondary antibodies and DAPI, successively, and captured by CLSM (A1/SIM/STORM, Nikon, Japan).

Safety evolution of lysoTRAP

For comprehensive safety evaluations, the dosage, frequency, and source of lysoTRAP via pulmonary inhalation were included in the scope of investigation. For lung respiratory function, the respiratory frequency and tidal volume of mice were collected via FinePointe Whole-body Plethysmograph 4-Site System (WBP, BUXCO, American). For histological evaluation, dissected lungs and tracheas were sectioned into 10 μm slices and subsequently stained with hematoxylin and eosin (H&E), and then imaged by the Vectra platform (v 3.0.5, PerkinElmer, USA). For inflammatory cell recruitment, the proportion of macrophages (CD11b + F4/80 + ), monocyte (CD11b + Ly6c + Ly6G-) and neutrophil (CD11b + Ly6c- Ly6G + ) were measured using CytoFLEX LX flow cytometer (Beckman Coulter, USA), and analyzed using CytExpert software (version 2.3). For inflammatory factor release, the concentration of IL-6, TNF and IFN-γ in the lungs was detected by ELISA according to the manufacturer’s instructions (Solarbio).

Mouse LAMP-1 and human ACE2 protein binding titers of serum IgG

C57BL/6 mice inhaled lysoTRAP at 0, 1, and 3 day. Serum of mouse was collected on 7, 14, 21, and 28 day. Binding titers of serum IgG to mouse LAMP-1 and human ACE2 protein were determined by ELISA. Briefly, 96-well plates (Corning) were coated with 1 μg/mL of mouse LAMP-1 or human ACE2 protein overnight at 4 °C in coating buffer, and blocked in 5% bovine serum albumin in PBS for 2 hours at 37 °C. Serially diluted serum was added to the ELISA plates and incubated for 1 hour at 37 °C. The plates were washed with 1× PBS containing 0.05% Tween-20 (PBST), followed by the addition of 100 µL of HRP-conjugated goat anti-mouse IgG with a 1:10000 dilution. After being incubated at 37 °C for 0.5 hours, plates were again washed with PBST. Then the plates were developed with 3,3′,5,5′-tetramethytlbenzidine for 10 min at room temperature, and the reaction was stopped with 2 M H₂SO₄. The absorbance at 450 nm was measured by a microplate reader. The endpoint titers were defined as the highest reciprocal dilution of serum to give an absorbance greater than 2.1-fold of the background values from control mice.

Programmed performance of lysoTRAP in capturing, internalizing, and degrading SARS-CoV-2 pseudotyped virions in vivo

LysoTRAP capturing SARS-CoV-2 pseudotyped virions

1 × 10⁶ TU BODIPY-labeled pseudotyped virions were administrated into C57BL/6 mice via thoracic injection. 1 h later, the normal C57BL/6 mice were administered with Cy5-labeled lysoTRAP, naked lysosomes, or free ACE2 via pulmonary inhalation. At 1 d, mice were sacrificed, and lungs were collected and sectioned into 10 μm slices. After staining with DAPI, the lung slices were mounted for imaging by CLSM (A1/SIM/STORM, Nikon, Japan).

For thoracic injection, sterile hypodermic syringe matched with 28 G needle was inserted 4-7 mm from the side of the mouse’s left chest between the 7th and 8th ribs. At each thoracic injection, 50 μl pseudotyped virions were injected into the pleural cavity by depressing the syringe with a constant force.

LysoTRAP degrading SARS-CoV-2 pseudotyped virions

1 × 10⁶ TU pseudotyped virions were administrated into C57BL/6 mice via thoracic injection. 1 h later, the normal C57 mice were administered with lysoTRAP, naked lysosomes, or free ACE2 via pulmonary inhalation. At 1 d or 2 d, mice were sacrificed and lungs were collected. Partial lungs were homogenized with RIPA to extract viral protein for subsequently WB analysis. Partial lungs were homogenized with Trizol to extract viral RNA for subsequently q-PCR analysis.

In vivo clearance of pseudotyped SARS-CoV-2 virions by lysoTRAP

Same pseudotyped virions inoculation and lysoTRAP inhalation procedures of above-mentioned normal C57BL/6 mice were applied in this model. In the ex-vivo imaging experiments, mice were sacrificed at 2 d and lungs were collected for imaging by using an IVIS imaging system (PerkinElmer, USA). For histological analysis, lungs were sectioned into 10 μm slices and stained with DAPI, which followed the imaging by CLSM (A1/SIM/STORM, Nikon, Japan).

In vivo clearance of authentic SARS-CoV-2 by lysoTRAP in hamster model

This study was conducted in a biosafety level 3 (BSL3) laboratory following institutional biosafety guidelines by the Institute of Medical Biology, Peking Union Medical College, Chinese Academy of Medical Sciences, Kunming, China. Briefly, hamsters were challenged with 2 × 10⁴ 50% tissue culture infective dose (TCID50) of authentic SARS-CoV-2 (CCPM-B-V-049-2112-18) via the intranasal route. Subsequently, the hamsters were randomized into two treatment groups, which received pulmonary inhalation of either PBS or lysoTRAP (prepared from lysosomes sourced from hamster macrophages) at a dose of 5 mg particles per kg of body weight at 1 h, 1 d and 2 d after challenge. At 3 d, the lung tissues were collected for viral burden and histological analysis.

For SARS-CoV-2 RNA copies detection, partial lungs were homogenized with Trizol, and isolated RNA were measured by q-PCR with commercially available One Step PrimeScript q-PCR Kit (RR064A, TCI) on a CFX96 real-time PCR detection system (Bio-Rad). The primers and probes published by WHO were used to detect RNA copies of SARS-CoV-2, with sequences (Sangon Biotech) as follows: E_Sarbeco-F, ACAGGTACGTTAATAGTTAATAGCGT; E_Sarbeco-R, ATATTGCAGCAGTACGCACACA; E_Sarbeco-probe, FAM-ACACTAGCCATCCTTACTGCGCTTCG-BHQ1; Omi-F, GACCCCAAAATCAGCGAAAT; Omi-R, TCTGGTTACTGCCAGTTGAATCTG; Omi-probe, FAM-ACTCCGCATTACGTTTGGTGGACC-BHQ1.

For histological analysis, lungs were sectioned into 10 μm slices and were successively stained with S fluorescent antibody and DAPI, and captured by CLSM (A1/SIM/STORM, Nikon, Japan). For pathological observation, the harvested left lungs were sectioned into 10 μm slices and subsequently stained with H&E, and then imaged by the Vectra platform. For inflammatory factor levels determination, partial lungs were homogenized with Trizol and processed with commercially available BeyoFastTM SYBR Green One-Step qRT-PCR Kit (D7268s, Beyotime) on a CFX96 real-time PCR detection system (Bio-Rad), with the primers sequences (Sangon Biotech) as follows: IL-6-F, AGGATACCACTCCCAACAGACCT; IL-6-R, CAAGTGCATCATCGTTGTTCATAC; TNF-F, GCCTCTTCTCATTCCTGCTT; THF-R, TGGGAACTTCTCATCCCTTTG; Actin-F, CACCATGTACCCAGGCATTG; Actin-R, CCTGCTTGCTGATCCACATC.

h-lysoTRAP trapping authentic SARS-CoV-2

This study was under institutional biosafety guidelines by the Sinovac Life Sciences Co., Ltd. All samples were heat-inactivated to eliminate any complement activity. For lysoTRAP capturing and internalizing authentic SARS-CoV-2 (SARS-CoV-2/human/CHN/CN1/2020, GenBank number MT407649.1), QCM assay and TEM (JSM-6700, JEOL, Japan) imaging were performed as described previously. For lysoTRAP degarding authentic SARS-CoV-2, proteomic and polypeptide analysis via LC-MS, and capillary electrochromatography analysis and q-PCR detection were executed for determine the degradation of viral proteins and genome, respectively. For proteomic analysis, LC-MS was conducted by Q Exactive™ Hybrid Quadrupole-Orbitrap™ Mass Spectrometer with associated software (Thermo Proteome Discoverer, version 2.5.0.400) to analyze the degradation of SARS-CoV-2 proteins. Briefly, authentic SARS-CoV-2 virions were incubated with lysoTRAP. At the time points of 0 h, 2 h, 6 h, 12 h, and 24 h, sample materials were collected and analyzed with the same procedure as described for LC-MS based proteomic analysis of the lysosomes with or without LPS stimulation. The same amounts of tryptic peptides applied in LC-MS analysis ensured the normalization between each sample in the proteomics. For polypeptide analysis, degradation residue of SARS-CoV-2 proteins in the absence of trypsin digestion was filtered through a 10 kD strainer to isolated residual SARS-CoV-2 peptide, which was directly detected by LC-MS. Briefly, authentic SARS-CoV-2 virions were incubated with lysoTRAP or PBS solution. After 24 h incubation, PBS group was additionally added with same amount of lysoTRAP (anchored with disabled ACE2 protein) to match the protein concentration, and sample materials from PBS and lysoTRAP groups were collected. Then, the proteins of each sample were extracted by protein extraction solution containing 8 M urea and subsequently filtered through a 10 kD strainer to isolate residual SARS-CoV-2 peptides for analyzing degradation residue of SARS-CoV-2 proteins via polypeptide analysis. Finally, the obtained residual SARS-CoV-2 peptides were analyzed with the same procedure (step 3 to step 5; in the absence of step 1 and 2) as described for LC-MS based proteomic analysis of the lysosomes with or without LPS stimulation. The same amounts of residual peptides applied in LC-MS analysis ensured the normalization between each sample in the proteomics. For capillary electrochromatography analysis, capillary electrophoresis was conducted by QIAxcel Advanced (QIAGEN, Germany) with associated software (QIAxcel ScreenGel Software, version 1.6). For viral RNA levels determination, the isolated viral RNA was processed with commercially available BeyoFastTM SYBR Green One-Step qRT-PCR Kit (D7268s, Beyotime) on a CFX96 real-time PCR detection system (Bio-Rad), with the primers sequences (Sangon Biotech) as follows: ORF1a-F, GTTACTAAAATAAAACCTCATAATTCACATGAAG; ORF1a-R, AGTCCCTGTGAATTCATATATCTAAACT; ORF1b-F, ATGCTTACTAATGATAACACTTCAAGGTATTGGG; ORF1b-R, TTAATGTGACTCCATTAAGACTAGCTTGTTTGG; S-F, AACAATCTTGATTCTAAGGTTGGTG; S-R, GAAGTTCTTTTCTTGTGCAGG; ORF3a-F, AAAAGAGATGGCAACTAGCACTCTCC; ORF3a-R, GTAATACAACACAGTCTTTTACTCCAGATTCCC; E-F, GCTTTCGTGGTATTCTTGCTAGTTACAC; E-R, CACGAGAGTAAACGTAAAAAGAAGGTTTTACAAG; M-F, GCTTGCTGCTGTTTACAGAATAAATTGGA; M-R, AGAAAGCGTTCGTGATGTAGCAAC; ORF7a-F, CCTTGCTCTTCTGGAACATACGAGG; ORF7a-R, TCTTGAACTTCCTCTTGTCTGATGAACAG; ORF7b-F, TGCTTTTTAGCCTTTCTGCTATTCCTTG; ORF7b-R, TGCAGTTCAAGTGAGAACCAAAAGA; ORF8-F, TGATGACCCGTGTCCTATTCACTT; ORF8-R, TTAGGTTCCTGGCAATTAATTGTAAAAGGTAAACAG; N-F, CTACTACCGAAGAGCTACCAGACGA; N-R, CAGTTCCTTGTCTGATTAGTTCCTGGT; ORF10-F, TTACGATATATAGTCTACTCTTGTGCAG; ORF10-R, ACATCTACTTGTGCTATGTAGTTACG; Note that the copy area of each viral gene during q-PCR was in proportion to the length of each viral gene. The PCR conditions were as follows: 50 °C for 30 min (reverse transcription), 95 °C for 5 min (predegeneration), 42 cycles of 95 °C for 2 min, and 60 °C for 5 min (amplification). The mRNA levels were normalized according to the result at 0 h.

h-lysoTRAP clearing authentic SARS-CoV-2 on human lung organoids

Construction of human lung organoids

The human lung organoids were constructed by K2 ONCOLOGY company (China) according to a previously described method⁵⁰. The surgery normal lung tissues adjacent to tumors were obtained from patients with advanced non-small cell lung carcinoma after ethical approval were approved by the Biomedical Research Ethics Committee of Peking University First Hospital (No.2021-486) and informed consent from all participants or next of kin. The tissues were washed with cold phosphate-buffered saline (PBS) containing antibiotics and chopped into approximately 5 mm pieces with surgical scissors. Tissues were further washed with 10 mL advanced DMEM/F12 (Thermo Fisher Scientific, Waltham, MA) containing 1× Glutamax, 10 mM N-(2-hydroxyethyl)piperazine-N′-ethanesulfonic acid (HEPES), and antibiotics and digested in 10 mL advanced DMEM/F12 containing 2% fetal calf serum (FCS) and 2 mg/mL collagenase on an orbital shaker at 37 °C for 1–2 h. The pellet was resuspended in 10 mL advanced DMEM/F12 containing 2% FCS and centrifuged again at 400 g. Dissociated cells were collected in human organoid medium (OrganoProTM Huamn Lung Organoids Culture Kit, K2ONCOLOGY, China), suspended in growth factor reduced (GFR) Matrigel (Corning Inc., Corning, NY), and seeded. The Matrigel was then solidified and overlaid with 500 μL of complete human organoid medium, which was subsequently refreshed every 2 days.

h-lysoTRAP inhibiting authentic SARS-CoV-2 infection

This study was conducted in a biosafety level 3 (BSL3) laboratory following institutional biosafety guidelines by the Sinovac Life Sciences Co., Ltd. Cell clusters digested from human lung organoids were seeded in 96-well plates (1,000 cells/well) and incubated at incubator for 3-5 d. Then authentic SARS-CoV-2 (100 TCID50 /well) (SARS-CoV-2/human/CHN/CN1/2020, GenBank number MT407649.1 and SARS-CoV-2 Omicron variants) and h-lysoTRAP (100 μg/mL) were added into the 96-well plates and incubated at 37 °C in a 5% CO₂ incubator for 2 d. Here, EIDD-2801 and RBD antibody were singled out for reference and the amount of these two references matched the amount of ACE2 presented in the h-lysoTRAP. For SARS-CoV-2 RNA copies detection, lung organoids were homogenized with Trizol, and isolated RNA were measured by q-PCR with commercially available One Step PrimeScript q-PCR Kit (RR064A, TCI) on a CFX96 real-time PCR detection system (Bio-Rad). The primers and probes published by WHO were used to detect a region of E gene in the SARS-CoV-2 genome, with sequences (Sangon Biotech) as follows: E_Sarbeco-F, ACAGGTACGTTAATAGTTAATAGCGT; E_Sarbeco-R, ATATTGCAGCAGTACGCACACA; E_Sarbeco-probe, FAM-ACACTAGCCATCCTTACTGCGCTTCG-BHQ1 Omi-F, GACCCCAAAATCAGCGAAAT; Omi-R, TCTGGTTACTGCCAGTTGAATCTG; Omi-probe, FAM-ACTCCGCATTACGTTTGGTGGACC-BHQ1. For immunofluorescent staining, lung organoids were successively stained with ACE2 fluorescent antibody, S1 fluorescent antibody and DAPI, and captured by CLSM (A1/SIM/STORM, Nikon, Japan). For cell apoptosis upon the lung organoids, supernatant per well was collected and processed with LDH Cytotoxicity Assay Kit (Beyotime) to detect the release of lactic dehydrogenase (LDH) from organoids.

lysoTRAP inhibiting influenza virus infection

Preparation and characterizations of lysoTRAP (SA)

Distinct from the lysoTRAP clearing SARS-CoV-2, the baits of lysoTRAP clearing influenza virus (denoted as lysoTRAP (SA)) were Sialic Acids (SAs). Through a-2,6-sialyltransferases, an essential enzyme in the synthesis pathways of sialic acid oligosaccharides, SA could be decorated to the N-linked and O-linked glycosylation sites. Considering partial N-linked and O-linked glycosylation sites present on cytoplasmic tails of lysosomal membrane proteins, we could modify SA on the external surface of lysosomes, obtaining lysoTRAP (SA). Briefly, lysosomes purified according to above-mentioned method were mixed with cytidyl sialoside phosphate (CMP-Neu5Ac) and a-2,6-sialyltransferases at 37 °C. After 1 h incubation, the compound was processed with superhigh speed centrifugation to remove free CMP-Neu5Ac and a-2,6-sialyltransferases, and the precipitation was purified lysoTRAP (SA). To demonstrate the SA presented in the lysoTRAP (SA), the lysoTRAP (SA) was incubated with sambucus nigra lectin-AF488 and LAMP-2 fluorescent antibody in succession, followed by viewing by CLSM (A1/SIM/STORM, Nikon, Japan).

To explore the internalization mechanism of H1N1 by lysoTRAP (SA), FRET analysis was conducted. Briefly, lysosome or lysoTRAP lysosomal samples (naked lysosomes, lysoTRAP (SA) and lysoTRAP (SA) with Furin inhabator (1 nM chloromethylketone)) were labeled by Cy7-SE (excitation/emission: 755/785 nm), and pseudotyped SARS-CoV-2 virions were labeled by Cy5.5 (excitation/emission: 673/715 nm). After the incubation of lysosomal samples with pseudotyped SARS-CoV-2 virions at 37 °C for 1 h, the emission intensity of each lysosomal sample group from 700 nm to 850 nm was detected under the 673 nm excitation.

Preparation and characterizations of h-lysoTRAP (SA)

The h-lysoTRAP (SA) was prepared from h-lysosome by mentioned SA described method. The degradation ability of h-lysoTRAP (SA) to H1N1-PR8 virus in vitro was tested by Western blotting, using the N protein of H1N1 antibody (Abcam, ab104870). The RNA copies of H1N1-PR8 virus were detected by q-PCR. To explore the clearance of h-lysoTRAP (SA) to H1N1 virus, the h-lysoTRAP (SA) and H1N1 virus were simultaneously added to lung organoid. After 24 h inoculation, the infection of lung organoid was detected by q-PCR and CLSM. After 24 h inoculation, the infection of lung organoid was detected by q-PCR and CLSM. To determine the contribution of SA binding, we mixed HA (hemagglutinin) with h-lysoTRAP (SA) for occupying the H1N1 viral binding domain, thus obtaining a h-lysoTRAP (SA) with a non-functional binding moiety (denoted as h-lysoTRAP (SA-HA)). Then, H1N1-PR8 virus and samples (PBS, h-lysoTRAP(SA-HA), or h-lysoTRAP) were added to human lung organoids, simultaneously. Viral infection was detected by CLSM imaging of N protein expression and q-PCR analysis of H1N1-PR8 RNA copies in human lung organoids.

The clearance of replicated virus by lysoTRAP (SA) and h-lysoTRAP (SA)

Authentic H1N1-PR8 was mixed with MDCK cells or lung organoids, respectively. After 1 h of viral inoculation, H1N1-MDCK cells or H1N1-lung organoids mixture in the upper chamber of the TranswellTM model and untreated MDCK or lung organoids in the lower chamber, accompanied by the incubation of lysoTRAP (SA) or h-lysoTRAP (SA) in the upper chamber. After 3 days, the infection of MDCK cell or lung organoids in the lower chamber was detected by CLSM and q-PCR. N proteins (green) of H1N1 were stained with fluorescent antibody, the cytoskeleton (red) was stained by Nile red labeled phalloidin and the nuclei were stained with DPAI (blue).

LysoTRAP (SA) clearing influenza virus in mice model

This study was conducted in a BSL3 laboratory following institutional biosafety guidelines by the Academy of Military Medical Sciences. The PR8 strain and CA07 strain of influenza A virus (H1N1-PR8 and H1N1-CA07) were gifted from Professor Meng Qin of Beijing Advanced Innovation Center for Soft Matter Science and Engineering, College of Life Science and Technology, Beijing University of Chemical Technology, Beijing, China. About the trapping and clearing experiments in vitro were performed as above-mentioned in the SARS-CoV-2. C57BL/6 mice were challenged with 1000 TCID50 H1N1-PR8 or H1N1-CA07 via the intranasal route and lysoTRAP (SA) was administrated via pulmonary inhalation at 1 h and 2 d. At 5 d post-challenge, mice were euthanized and necropsied: mice and the lung were weighed and lung index was calculate as the weight of lung/the weight of mice; the harvested right lungs (about 0.1-gram lung) were homogenized with Trizol and processed with commercially available BeyoFastTM SYBR Green One-Step qRT-PCR Kit (D7268s, Beyotime) for viral RNA levels determination and inflammatory factor levels determination, with the primers sequences (Sangon Biotech) as follows: IL-6-F, AGGATACCACTCCCAACAGACCT; IL-6-R, CAAGTGCATCATCGTTGTTCATAC; TNF-F, GCCTCTTCTCATTCCTGCTT; THF-R, TGGGAACTTCTCATCCCTTTG; Actin-F, CACCATGTACCCAGGCATTG; Actin-R, CCTGCTTGCTGATCCACATC; H1N1-PR8-R, GGTGACAGGATTGGTCTTGTCTTTA; H1N1-PR8-F, CTTCTAACCGAGGTCGAAACGTA; H1N1-CA07-R:AGGGCATTYTGGACAAAKCGTCTA; H1N1-CA07-F: GACCRATCCTGTCACCTCTGAC. The harvested left lungs were sectioned into 10 μm slices and subsequently stained with H&E, and then imaged by the Vectra platform for pathological examination.

Statistical analysis

To show inhibition profiles across treatment groups (EIDD-2801, RBD antibody and h-lysoTRAP) and analyze the discrepancy among infection indexes for wild-type and Omicron stain, principal component analysis (PCA), clustering analysis and the visualization were performed by relevant analysis tools in Omicsmart (https://www.omicshare.com/tools/Home/Soft/getsoft). For other data, GraphPad Prism 8.4.3 and Origin 2021b were utilized for plotting and statistical analysis. All data were presented as mean ± SD and significance were calculated by two-tailed unpaired Student’s t-tests, or One-way ANOVA (ns, not significant; ∗p < 0.05; ∗∗p < 0.01; ∗∗∗p < 0.001; ∗∗∗∗p < 0.0001).

Reporting summary

Further information on research design is available in the Nature Portfolio Reporting Summary linked to this article.

• SEO Powered Content & PR Distribution. Get Amplified Today.
• PlatoData.Network Vertical Generative Ai. Empower Yourself. Access Here.
• PlatoAiStream. Web3 Intelligence. Knowledge Amplified. Access Here.
• PlatoESG. Carbon, CleanTech, Energy, Environment, Solar, Waste Management. Access Here.
• PlatoHealth. Biotech and Clinical Trials Intelligence. Access Here.
• Source: https://www.nature.com/articles/s41467-024-54505-6