Stem Cell

IFNγ-Stat1 axis drives aging-associated loss of intestinal tissue homeostasis and regeneration – Nature Communications

Time Stamp: September 29, 2023 8:00 PM
Source Node: 75652

Mice

Young (2–4 months old) and old (18–26 months old) male and female wild-type C57BL6/J, Lgr5-ki-eGFP-creER, and Olfm4-ki-eGFP-creER mice were group housed and maintained in a Specific Opportunist Pathogen Free (SOPF) animal facility in Fritz Lipmann Institute with 12 h of light/dark cycle and fed with a standard mouse chow at Temperature 20 ± 2 °C, rlH 55% ± 15. Experiments were conducted according to protocols approved by the state government of Thuringia Thüringer Landesamt für Verbraucherschutz (TLV) authority (licenses number: TG/J-0002858/A; TG/J-0003616/A; TG/J-0003681/A; FLI-17-109; FLI-18-005, FLI-20-005).

Small intestine crypt isolation

Small intestinal crypts were isolated using the established protocol⁶⁰ with some modifications. Briefly, mouse small intestine was dissected, washed in cold PBS. The villi-free intestinal pieces (2 cm) were washed with cold PBS and transferred to 5 mM EDTA/PBS, followed by two 30-min incubations at 4 °C on a rotator. The tissue was transferred to fresh cold PBS and manually shaken for 30 sec. The crypt solution was filtered using a 70 µm cell strainer and centrifuged at 450 × g for 5 min at 4 °C. Isolated crypts were immediately used or snap-frozen in liquid nitrogen and stored at −80 °C for further experiments. For RNA isolation, the crypts were immediately resuspended in QIAzol Lysis Reagent (Qiagen) and stored at −80 °C.

Intestinal stem cells isolation and sorting

To isolate the Lgr5-eGFP and Olfm4-eGFP ISCs, the freshly isolated crypts were dissociated with the mixture of 18 ml TrypLE Express, 2 ml of 10× DNase I Buffer (100 mM Tris-HCl pH 7.5, 25 mM MgCl₂, 5 mM CaCl₂) and 1 ml DNase I (10 mg/ml) for 30 min at 37 °C with brief vortexing every 10 min. The single-cell suspension was then passed through a 20 µm cell strainer and centrifuged at 800 × g for 5 min at 4 °C. Cell pellet was resuspended in 3 ml FACS staining medium (FSM) containing PBS supplemented with 2% Fetal Bovine Serum, 2.5 mM EDTA, 10 µM Y27632 and DAPI (1:1000). The single cell suspension was applied to FACS LSRII (BD Biosciences) and the Lgr5-eGFP^hi or Olfm4-eGFP ISCs were sorted for downstream analysis as previously described⁶¹.

Organoid culture

Small intestinal organoids were cultured according to the established protocol⁶². Briefly, isolated crypts were mixed with Matrigel and plated in 24-well plate. After polymerization of Matrigel, crypt culture medium (Advanced DMEM/F12, 1× Glutamax, 10 mM HEPES, N2 supplement (1:100), B27 supplement (1:50), 0.5 U/mL penicillin/streptomycin, 50 ng/mL mouse recombinant epithelial growth factor, 100 ng/mL mouse recombinant Noggin, and 500 ng/mL human recombinant R-spondin1) was added. For IFNγ treatment, two weeks grown organoids were passaged and at day 3, IFNγ (2 ng/ml) was added to them. After 24 h the organoids were collected, washed with PBS and processed for single-cell RNA-seq. For blocking of Stat1 signaling, organoids were treated with IFNγ 2 ng/ml with or without Ruxolitinib (10 µM) for 3 days and then collected for FACS or qRT-PCR analysis. IFNγ was used at the concentration of 0.2 ng/ml for re-seeding experiment and for Baricitinib (2 µM) experiment.

Annexin V staining

After single cell preparation from organoids as described above, cells were resuspended in 200 µl of 1× binding buffer and 1 μl of APC Annexin V from apoptosis detection Kit from BD Bioscience following incubation at RT for 15 min. After washing with 1× binding buffer, cells were resuspended in 1× binding buffer (100 µl) and analyzed using FACSAriaII (BD Biosciences) and data were analyzed using FlowJo software.

BrdU proliferation analysis

BrdU (10 µM) was added to organoids 6 h before harvesting. After single cell preparation from organoids as described above, the BrdU flow kit from BD Bioscience was used to quantify the percentage of proliferating cells in organoid culture. Cells were analyzed using FACSAriaII and FlowJo software was used for analysis.

Co-culture experiment

IFNγ treated (0.2 ng/ml for 2 days) or untreated organoids were co-cultured with freshly isolated and sorted Cd45⁺ cells from young mice for 3 days. Roughly 2 × 10⁵ Cd45⁺ cells were mixed with 100 organoids and resuspended in Matrigel (30% final concentration). Then, immune cells were isolated from culture, and after staining, they were analyzed using FACSAriaII. FlowJo software was used for the percentage calculation of different population of immune cells.

In vivo blocking of IFNγ

Old mice were injected intraperitoneally with anti-mouse IFNγ (25 mg/kg) or anti-IgG1 antibody for two weeks (3 injections per week). Mice were sacrificed for organ harvest 4 days after the last injection. For regeneration experiment, after blocking of IFNγ, 5-fluorouracil (5-FU) (150 mg/kg) or DMSO as control were intraperitoneally (i.p.) injected one day after the last injection and mice were sacrificed for organ harvest 7 days later.

RNA and DNA isolation

Total RNA from crypts was isolated using QIAzol Lysis reagent (Qiagen) followed by isopropanol precipitation. RNA from Lgr5-eGFP^hi ISCs sorted by FACS were isolated using ZR-Duet™ DNA/RNA MiniPrep Plus Kit (Zymo Research) following the manufacturer’s instructions. Isolated RNA was quantified on Nanodrop 8000 (Thermo Fisher Scientific) and on Qubit 3.0 (Thermo Fisher Scientific). The quality of isolated RNA was analyzed by Fragment Analyzer (Agilent).

RNA-sequencing library preparation

Total ribo-depleted RNA-seq library preparation was performed as described previously⁶³. In brief, 50–500 ng of total RNA were depleted of ribosomal RNA using the Ribo-Zero™ Gold Kit H/M/R Kit (illumina) following manufacturer’s instructions. Ribo-depleted RNA was resuspended in 17 µl of EFP buffer (illumina), heated to 94 °C for 8 min, and used as input for first strand synthesis, using the TruSeq™ RNA Library Preparation Kit v2 (illumina) following manufacturer’s instructions.

Cell preparation for scRNA-sequencing

According to the experiment, proximal small intestinal crypts or intestinal organoids were resuspended in 1 ml of Single-Cell Isolation Solution (TrypLE supplemented with 1 mg/ml DNase I, 5 mM MgCl₂, 80 µM Y27632) and incubated for 20 min at 37 °C with short vortexing after first 10 min of incubation. Reaction was quenched by addition of 29 ml ice-cold PBS and cells were centrifuged at 800 × g for 5 min at 4 °C. Cell pellet was resuspended in FSM supplemented with 80 µM Y27632. Cells were pre-blocked with the TruStain FcX anti-mouse antibody according to the manufacturer’s specifications. Cells were then treated with CD326 (EpCAM) (G8.8), PE-Cyanine7 coupled rat monoclonal antibody, and different TotalSeq anti-mouse Hashtag antibodies for 30 min on ice in the dark. The cells were then centrifuged at 450 × g for 5 min at 4 °C, resuspended in 500 µl fresh FSM and FACS sorted. EpCAM⁺ single cells from young and old mice were flow-sorted into a BSA-coated tube containing 1.5 µl PBS with 0.04% BSA.

Lamina propria immune cells were isolated from proximal intestinal tissue. Briefly, after crypt isolation, tissue was chopped and incubated in 3 ml of 1 mg/ml collagenase-D and 1 mg/ml DNase I in RPMI medium supplemented with 2% FBS in an incubator shaker (80 rpm) for 50 min at 37 °C. Tissue was pipetted up and down several times with a p1000 tip. The supernatant was passed through a 100 μm strainer into RPMI medium supplemented with 2% FBS. The remaining tissue was smashed with a syringe plunger and washed with RPMI medium supplemented with 2% FBS to collect the maximum number of cells. The supernatant was centrifuged at 450 × g, 4 °C for 5 min. The pellet was resuspended in 40% percoll in RPMI medium supplemented with 2% FBS. The cell suspension was carefully pipetted over 80% percoll in a falcon tube in order to create a gradient. The falcon tubes were centrifuged at 1600 ×g, RT for 20 min (centrifuge break disabled). The immune cells were collected carefully from border of the two percoll concentrations and washed with PBS supplemented with 2% FBS. The suspension was centrifuged at 450 × g, 4 °C for 5 min. Pellet was resuspended in PBS supplemented with 2% FBS and procced for staining. Cells were blocked with TruStain FcX anti-mouse antibody according to manufacturer’s specifications. Staining and hash-tagging were performed at the same time with FITC-coupled CD45 and different TotalSeq anti-mouse Hashtag antibodies for each compartment. Details on antibodies can be found in Supplementary Table S2.

Droplet-based scRNA-sequencing

scRNA-seq was performed according to the 10X Genomics protocols. Briefly, the prepared single cell suspension was carefully mixed with reverse transcription mix using the Chromium Single Cell 3’ Library & Gel beads chemistry v2 (10x Genomics) and loaded into a Chromium Single Cell A Chip (10x Genomics).

During the encapsulation process in the 10X Genomics Chromium system, the cells were lysed within the droplet and released polyadenylated RNA, which then bound to the barcoded bead that was captured with the cell. Following the guidelines of the 10x Genomics’ user manual, the droplets were directly subjected to reverse transcription, the emulsion was broken and cDNA was purified using Dynabeads MyOne Silane (Thermo Fisher Scientific). After the PCR amplification of cDNA with eight cycles, it underwent purification and a quality control check on the Fragment Analyzer (Agilent).

The cDNA was fragmented for five minutes and dA-tailed, followed by an adapter ligation step and an indexing PCR of 10 cycles in order to generate libraries. After quantification, the libraries were sequenced on NextSeq500 platform (illumina) using a high-output flowcell in PE mode (R1: 26 cycles; I1: 8 cycles; R2: 57 cycles).

High-throughput sequencing

All the samples for genome-wide experiments were sequenced on the HiSeq2500, and NextSeq500 platform (Illumina, San Diego, CA, USA).

Quantitative real-time PCR

cDNA synthesis was done with 1 µg of total RNA by using iScript cDNA Synthesis Kit (Biorad) according to the manufacturer’s protocol. Quantitative real-time PCR analysis was performed on Corbett RotorGene 6000 (Qiagen) using SYBR GreenER qPCR SuperMix (Thermo Fisher Scientific). Each reaction was performed in a 19 µl qPCR mix and 1 µl of 1∶10 diluted cDNA. qRT-PCR conditions were 10 min at 95 °C, then 50 cycles of 10 s at 95 °C, 10 s at 56 °C, 20 s at 68 °C and 3 s at 68 °C. To obtain amplicon data, a melting curve analysis was performed after each PCR run: each sample was analyzed in triplicate. The concentrations of samples were calculated using relative standard curve method. All analyzed gene expressions were normalized to housekeeping gene Beta-actin. Primers were designed using the NCBI Primer-BLAST tool and their sequences are listed in Supplementary Table S1.

Chromatin Immunoprecipitation (ChIP)-qRT-PCR analysis

Chromatin Immunoprecipitation was performed on IFNγ treated and untreated organoids as previously described⁶³. Briefly, treated organoids with IFNγ (2 ng/ml) for 24 h were washed, disrupted, and cross-linked by addition of formaldehyde to 1% for 10 min at RT, quenched with 0.125 M glycine for 5 min at RT, and then washed twice with cold PBS. The cross-linked organoids were resuspended in SDS ChIP Buffer (20 mM Tris-HCl pH 8.0, 10 mM EDTA, 1% SDS and protease inhibitors), incubated on a rotator for 30 min at 4 °C, sonicated for 18 cycles on high power setting (30 s ON, 30 s OFF) using the Bioruptor Next Gen (Diagenode) and centrifuged at 12,000 × g for 10 min at 4 °C. The isolated chromatin was diluted 10-fold with ChIP dilution buffer (16.7 mM Tris-HCl pH 8.0, 0.01% SDS, 1.1% Triton X-100, 1.2 mM EDTA, 167 mM NaCl) and incubated with 4 µg of antibody overnight at 4 °C on a rotator. Protein G-conjugated magnetic beads (Dynal, Thermo Fisher Scientific) were saturated with PBS/1% BSA and sonicated salmon sperm overnight at 4 °C. Next day, samples were incubated with saturated beads for two hours at 4 °C on a rotator, and subsequently washed with 1 ml of cold Low salt buffer (20 mM Tris-HCl pH 8.0, 0.1 % SDS, 1% Triton X-100, 2 mM EDTA, 150 mM NaCl), 1 ml of cold High salt buffer (20 mM Tris-HCl pH 8.0, 0.1 % SDS, 1% Triton X-100, 2 mM EDTA, 500 mM NaCl), 1 ml of cold LiCl buffer (10 mM Tris-HCl pH 8.0, 1% DOC, 250 mM LiCl, 1 mM EDTA, 1% NP-40), and twice with 1 ml of cold TE buffer (10 mM Tris-HCl pH 8.0, 1 mM EDTA). The immunoprecipitated chromatin was eluted with 200 µl of Elution buffer (10 mM Tris-HCl pH 8.0, 1 mM EDTA, 1% SDS, 150 mM NaCl, 5 mM DTT) for 30 min at RT on a rotator, and decrosslinked at 65 °C overnight. The decrosslinked DNA was purified using QiaQuick PCR Purification Kit (Qiagen) according to the manufacture’s instruction. The immunoprecipitated DNA was analyzed by quantitative real-time PCR using the SYBR GreenERkit (Invitrogen) and the following primers: H2-Ab1 (Forward: CAGGTCCTGACCCCTGTTTA, Reverse: GTTTCAGGAAGGGACAGCCA), Wars (Forward: CTGGCTGTGTAGTCCAAGGG, Reverse: GAAAGGGTGTGGCAAAGCAG). The antibodies used for ChIP were: rabbit anti-Stat1 (9172, Cell Signaling), rabbit anti-IgG (12–370, Millipore). All the antibodies were used at a concentration of 1:250. Details on antibodies can be found in Supplementary Table S2.

Immunofluorescence on frozen tissue sections

Small piece (2 cm) of proximal intestine (duodenum) was fixed in 4% PFA in PBS overnight at 4 °C on a rotator. After fixation, the tissue was washed three times with PBS for 15 min at RT, and then dehydrated in 20% Sucrose overnight at 4 °C on a rotator. Subsequently, the fixed tissue was mounted in cast using optimal cutting temperature (OCT) compound, slowly frozen using liquid nitrogen, and stored at −80 °C. For immunofluorescence staining, 14 µm sections were cut and the tissue was permeabilized in PBS supplemented with 0.1% Triton X-100 for 10 min and washed three times with PBS for 15 min at RT. The permeabilized tissue was blocked for 1 h with 10% FBS in PBS supplemented with 0.1% Tween 20 (T-PBS), and then incubated with primary antibody in T-PBS supplemented with 2% FBS overnight in a humid chamber at 4 °C. After incubation with primary antibody, the tissue was washed three times with PBS for 15 min at RT, and then incubated with secondary antibody in PBS supplemented with DAPI (1:1000) for 1 h at RT. After incubation with a secondary antibody, the tissue was washed three times with PBS for 15 min at RT and mounted. Imaging was performed at the Fritz Lipmann Institute – Core Facility Imaging. Images were acquired using the Axiovert 200 inverted microscope with ApoTome slider module for optical sectioning. Imaging was performed at 200x total magnification.

Primary antibodies used for immunofluorescence were: rabbit monoclonal anti-EpCAM [EPR20533-63] (Abcam; 1:250); rat monoclonal anti-Mouse MHC Class II (I-A) (NIMR-4), PE (Thermo Fisher Scientific; 1:250). Secondary antibodies used for immunofluorescence were: Alexa Fluor 488 donkey anti-rabbit IgG (H + L) (Thermo Fisher Scientific; 1:500); Alexa Fluor 568 goat anti-rat IgG (H + L) (Thermo Fisher Scientific; 1:500). Details on antibodies can be found in Supplementary Table S2.

Immunofluorescence on paraffin-embedded tissue sections

5 μm paraffin sections were deparaffinized by three times immersion in xylene (5 min each time) and rehydrated by immersion in a series of graded ethanol dilutions 100%, 90%, and 70% for 5 min each. Epitope retrieval was performed by preheating the sections 5 min at full power microwave (900 W) in 10 mM sodium citrate buffer pH 6.5 until boiling, followed by 10 min at a sub-boiling temperature (600 W). After cooling down for 20 min, the sections were washed in PBS and blocked with 1% BSA/PBS for 1 h at RT in humid chamber. Sections were stained with primary antibodies: anti-Olfm4 (Cell Signaling, D6Y5A, #39141), anti-Muc2 (abcam, ab90007), and anti-Chga (abcam, ab15160) in 1% BSA/PBS for 16 h at 4 degree in humid chamber. This was followed by washing in PBST (0.1% Tween 20, 3 × 5 min) and subsequent incubation for 30 min with secondary anti-rabbit IgG conjugated with AF488. All the antibodies were used at concentration of 1:250. The slides were washed in T-PBS (0.1% Tween 20, 3 × 5 min) and mounted with mounting medium including DAPI. Images of stained sections were acquired using Axio Imager from Zeiss and analyzed by the ZEN blue software v2 (Zeiss). For further image analysis, the graphics tools for counting and measuring the ZEN software were used. Details on antibodies can be found in Supplementary Table S2.

RNA-sequencing data analysis

Fastq files quality check was performed using FastQC v0.11.5. The fastq files were mapped to the mm9 genome using TopHat v2.1.0 with the following parameters –bowtie1 –no-coverage-search -a 5. The number of reads covered by each gene is calculated by HTSeq-Count 0.11.2 with -s no -a 0 -t exon -m intersection-nonempty parameters. Before further analysis, all the rRNA genes are removed from the count data. For calculating DEGs and normalized count, DESeq2 R package v1.20.0 was used with the default parameters. For Pearson correlation analysis and plotting the expression, the normalized count was used.

Gene set enrichment analysis

For gene set enrichment analysis, normalized counts (for each gene in all of the samples) were scaled using the scale function in R (with center = TRUE, scale = TRUE parameters). The average of Z scores were calculated for each group and used for drawing plots and downstream analysis. The p values were calculated using Wilcoxon paired test (two-tailed). Boxplots show the quartile distribution of the data. A distance of 1.5 times the interquartile range (Q3–Q1) is measured out below the lower quartile and a whisker is drawn up to the lower observed point from the dataset that falls within this distance. All other observed points are plotted as outliers.

scRNA-sequencing data analysis for intestinal crypt cells

The raw sequencing data was processed with the ‘count’ command of the Cell Ranger software (v2.1.0, 10X Genomics) with the default options. The required reference was built with the ‘mkref’ command of Cell Ranger based on the murine genome mm10 as well as the gene annotation from Ensembl (v87) as input. The annotation was filtered with the ‘mkgtf’ command of Cell Ranger to include only protein-coding, lincRNA, and antisense gene features (‘–attribute=gene_biotype:protein_coding –attribute=gene_biotype:lincRNA –attribute=gene_biotype:antisense’). The count file was directly uploaded into R using cellrangerRkit package v2.0.0. Before further analysis on the count data, non-expressed genes were removed and the counts were normalized to the total number of counts in each cell (using normalize_barcode_sums_to_median function in cellrangerRkit package) and transformed to log 10 for all of the downstream analysis. PCA was calculated using prcomp function with center = TRUE,scale. = TRUE parameters. Clustering of the cells was done using kmean clustering (center = 9, nstart = 10) and the cell type of each defined cluster was determined using the well-known markers for each cell types. Using 9 clusters, Tuft and Enteroendocrine cells were in in the same cluster, so we separated these cell types by re-clustering using kmean (center = 2, nstart = 10). To define markers for each cluster we used order_cell_by_clusters and prioritize_top_genes (method = “sseq”, min_mean = 0.1), respectively. The expression of markers was compared between the desired cluster versus all other cells (using prioritize_top_genes function) and the genes with log2 fold change ≥ 2 and adjusted p value < 0.05 were selected as the marker.

scRNA-sequencing data analysis for lamina propria immune cells and intestinal organoid cells

The Cell Ranger Software Suite (Version 3.1.0) was used to perform sample de-multiplexing, barcode processing, and single-cell 3’ UMI counting with mm10-3.0.0 as the reference genome. Effective reads (UMI) per cell were scaled to the same level (median UMI counts per cell: 1330) in each sample by downsampling raw reads. Cells with hashtag reads were defined into different categories of “single hashtag”, “double hashtag”, “triple hashtag” and “multiple hashtag” by the hashtag ratio in each cell. Cells with less than 10 reads mapping to hashtags were discarded with only those defined as “single hashtag” kept for downstream analysis. Afterwards, gene-barcode matrix of all samples was integrated with Seurat v3. Following criteria were then applied to each cell, i.e., for immune cells: gene number between 200 and 1500, UMI counts <5000, and mitochondrial gene normalized counts below 8; for intestinal organoid cells: mitochondrial gene normalized counts below 20. After filtering, a total of remaining 8997 immune cells (4423 cells for young samples, 4574 cells for old samples) and 13,054 intestinal organoid cells (5843 cells for control group, 7211 cells for IFNγ-treated group) were left for following analysis. Batch effect was removed by “canonical correlation analysis (cca)” correction when integrating the single cells from control organoids and IFNγ-treated organoids.

Dimension reduction, graph clustering, and UMAP/t-SNE visualization

For immune cells, a subset of features (7425 genes) that exhibit high cell-to-cell variation in the dataset is selected with the method of “mvp” in Seurat (with mean cutoff between 0.0125 and 2; dispersion cutoff >0.9), which could identify variable features while controlling for the strong relationship between variability and average expression. Basically, features were divided into 20 bins based on their average expression, and z scores were calculated for dispersion within each bin.

For intestinal organoid cells, a subset of features (2000 genes) that exhibit high cell-to-cell variation in the dataset is selected with the method of “vst” in Seurat. The feature values were standardized using the observed mean and expected variance given by the fitted line model of log(variance) and log(mean). Feature variance is then calculated on the standardized values after clipping to a maximum.

Focusing on variable genes in downstream analysis helps to highlight biological signal in single-cell datasets. We conservatively used all the variable genes identified by “mvp” or “vst” method for dimension reduction to ensure that most of the variability in the dataset was maintained. Dimension reduction of the filtered hashtag-isolated gene-barcode matrix was applied by PCA on these variable genes. Then Uniform Manifold Approximation and Projection (UMAP) for intestinal organoids and t-distributed stochastic neighbor embedding (t-SNE) for immune cells was performed on the top 20 principal components for visualizing the cells. Meanwhile, graph-based clustering was executed on the dimension-reduced data with Seurat v3.

Differential analysis for clusters and identification of cluster-specific genes

Wilcoxon rank sum test, as implemented in Seurat v3 was adopted to achieve differential analysis. For each cluster, DEGs in aging were generated with the average gene expression across all cells in each cluster. In the same manner, the mean expression of each gene from each cluster was compared to that from cells in all other clusters to identify genes that are enriched in a specific cluster. The top few cluster-specific genes in the rank based on their expression difference from each cluster were examined. The centered expression of each gene was used for visualization by heatmap. Classification of immune cell subsets was inferred from the annotation of cluster-specific genes. Different cell types were designated manually by referring to known markers (Supplementary Data S4).

Testing for shifts in cell proportions in immune cells and intestinal organoids

Odds ratio was calculated to represent the change in relative abundance of each cell type in aging or treatment. Dramatic changes in the frequency of some cell types were observed in these two datasets. The statistical significance of these shifts was assessed by calculating, regarding each condition comparison and cell type, the exact hypergeometric probability (without replacement) of the observed change in cell numbers.

Specifically, given that m and n total cells (of all cell types) are sequenced in a treatment and control condition respectively, we test, for a given cell type, whether the number of k and q of observed cells of type C in total and treatment condition respectively, significantly deviates from a null model given by the hypergeometric distribution. The probability of observing these values was calculated using the R function ‘phyper’ from the ‘stats’ package, using the command: p = phyper(q, k, m, n) and was reported as a hypergeometric p value. Confidence intervals for the odds ratio were computed using the R function ‘fisher.test’.

Gene functional annotation

Statistically significant DEGs (adjusted p value < 0.05) were uploaded to QIAGEN IPA software for Canonical Pathway and Upstream Regulator analysis (Qiagen 2020, ver. 01-18-06). Enriched pathways and candidate upstream regulators could be retrieved from IPA.

Motif prediction

Motif prediction was proceeded by software HOMER-v4.9.1 with a setting of “-start −1000 -end 500 -len 8,10 -p 4 -b”. Binomial distribution was used to calculate p values in the enriched motifs. Analysis was performed on the promoters of the genes known to be markers of secretory cells in the intestine versus promoters of the genes known markers of enterocytes.

Statistics and reproducibility

No statistical method was used to predetermine sample size. No data were excluded from the analyses. The Investigators were not blinded to allocation during experiments and outcome assessment.