iFlpMosaics enable the multispectral barcoding and high-throughput comparative analysis of mutant and wild-type cells

Mice

All mouse husbandry and experimentation were conducted using protocols approved by local animal ethics committees and authorities (Comunidad Autónoma de Madrid and Universidad Autónoma de Madrid CAM-PROEX 177/14, CAM-PROEX 167/17, CAM-PROEX 164.8/20 and PROEX 293.1/22). The mouse colonies were maintained in racked individual ventilation cages according to current national legislation. The mice had dust and pathogen-free bedding and sufficient nesting and environmental enrichment material for the development of species-specific behavior. All mice had ad libitum access to food and water in environmental conditions of 45–65% relative humidity, temperatures of 21–24 °C and a 12–12 h light–dark cycle. To preserve animal welfare, mouse health was monitored with an animal health surveillance program that followed the Federation of European Laboratory Animal Science Associations (FELASA) recommendations for specific pathogen-free facilities.

We generated and used Mus musculus lines on the C57BL6 or C57BL6 × 129SV or B6CBAF1 or C57BL6 × DBA genetic backgrounds. All mice were backcrossed to C57Bl6 for several generations. To generate mice for analysis, we intercrossed mice aged between 7 and 30 weeks. We analys¡zed mice of both sexes. We do not anticipate any influence on our data of mouse sex. The following mouse lines were used and intercrossed: Tg(Cdh5-CreERT2)²⁹, Tg(iSuRe-Cre)⁸, Notch1^flox30, Notch2^flox31, Notch3^flox32, Rbpj^flox33, Myc^flox34, Mycn^flox35, Dll4^flox36, Kdr^flox37, Foxo1/3/4^flox23, Rosa26-EYFP³⁸, Rosa26-iChr2-Mosaic¹³, Tg-iMb2-Mosaic or iCre^{MYFP/MTomato/MTFP113}, Gt(Rosa)26^{tm3(CAG-FlpO-ERT2)Ali10}, Gt(Rosa)26Sor^{tm14(CAG-LSL-tdTomato)Hze39}, R26–iFlp^{MTomato-2A-Cre/MYFP-2A-FlpO}, ACTB:FlpE allele¹⁵ and Apln-FlpO¹⁶. The following mouse lines were produced in this study: R26–iFlp^{MTomato-Cre/MYFP}, Tg-iFlp^{MTomato-H2B-GFP-Cre/MYFP-H2B-Cherry-FlpO}, Tg(INS-CAG-FlpO-ERT2), Tg(INS-CAG-DreERT2), Tg(Cdh5-FlpO-ERT2), Tg-iFlp^{H2B-Cherry/GFP/Cerulean}, Tg-iDre/Flp^Progenitor and MKi67-2A-DreERT2.

The Tg-iFlp^{MTomato-H2B-GFP-Cre/MYFP-H2B-Cherry-FlpO}, Tg(INS-CAG-FlpO-ERT2), Tg-iFlp^{H2B-Cherry/GFP/Cerulean} and Tg-iDre/Flp^Progenitor mouse alleles were generated by standard DNA injection into mouse eggs and screening of several transgenic founders, as indicated in the main text or figures. The chromosomal position of these transgenic alleles was mapped by targeted locus amplification and sequencing (Cergentis). The Tg-iFlp^{MTomato-H2B-GFP-Cre/MYFP-H2B-Cherry-FlpO} allele is in chromossome 3:44,078,483, the Tg-iFlp^{H2B-Cherry/GFP/Cerulean} allele is in chromossome 16:66,008,291 and the Tg-iDre/Flp^Progenitor allele is in chromosome 13:90,390,612. The Cergentis report also indicated that there are no genes in the integration sites for all these three alleles. The R26–iFlp^{MTomato-2A-Cre/MYFP-2A-FlpO} allele was generated by CRISPR-assisted gene targeting of the Rosa26 locus in G4 ES cells, using the guide GACTGGAGTTGCAGATCACGA_GGG (IDT DNA) and a donor DNA, as previously described¹⁶. The targeted ES cells were used for mice production. After eggs from these mice were injected with guide RNAs recognizing the sequence CCTGTGCAAGACCCCCCCCA_AGG and GGCGGATCTGATAAGCTCGA_GGG and a donor DNA coding for YFP-WPRE-pA to delete the 2A-FlpO cassette and obtain the R26–iFlp^{MTomato-Cre/MYFP} allele. The Tg(Cdh5-FlpO-ERT2) line was generated by CRISPR–Cas9-assisted gene targeting of the existing Tg(Cdh5-CreERT2) line²⁹ in mouse eggs, using the guide AAGCTTATCGATACCGTCGA_CGG and a donor DNA containing the Cdh5-FlpO-ERT2 sequence. Tg(INS-CAG-DreERT2) mice were generated by CRISPR–Cas9 using guide RNAs (GATGTCGAACTGGCTCATGG_TGG and AACAGGCGGATCTGCGTACG_CGG) targeting the existing FlpO sequence contained in the prescreened Tg(INS-CAG-FlpO-ERT2) transgene and a donor DNA containing the CAG-DreERT2 sequence. The Mki67-2A-DreERT2 line was generated by CRISPR–Cas9 using guide RNA ACTGGAGGTGAAAACCACAC_TGG targeting a sequence after the stop codon of the Mki67 gene and a donor DNA fragment containing the sequence MKi67-2A-DreERT2-WPRE-sv40pA-MKi67 (Extended Data Fig. 7f). The injection mixtures consisted of 0.305 mM of the described crRNAs (IDT) and tracrRNA (IDT, catalog 1072533) and 20 ng µl⁻¹ Cas9 nuclease (Alt-R Streptococcus pyogenes HiFi Cas9 Nuclease V3, 100 µg, catalog 1081060). The founders were initially screened by polymerase chain reaction (PCR) with the primers described in Supplementary Table 1.

To induce CreERT2, FlpO-ERT2 or DreERT2 activity in adult mice, 1 g tamoxifen (Sigma-Aldrich, P5648_1G) was dissolved in 50 ml corn oil (stock tamoxifen concentration, 20 mg ml⁻¹), and aliquots were stored at −20 °C. The animals received intraperitoneal injections of 50–150 µl of this stock solution (total dose, 1–3 mg tamoxifen per animal at 40–120 mg kg⁻¹), as indicated in the figures. For treatment of pregnant females, the tamoxifen was dissolved together with progesterone to reduce miscarriage (2 mg tamoxifen and 1 mg progesterone per mouse). To activate recombination in pups, 4-OHT was injected at the indicated stages at a dose of 40 mg kg⁻¹ or 4 mg kg⁻¹ body weight, as indicated in the figures. All mouse lines and primer sequences required for genotyping are provided in Supplementary Table 1.

Immunofluorescence on tissue cryosections

For multispectral iFlpMosaics tissue collecting, the mice were killed in CO₂ chambers, 10 ml of 50 mM KCl were injected into the left ventricles and whole mice were perfused with 3.7–4% formaldehyde (ITW Reagents, 252931) at pH 7. The explanted tissues were postfixed for 2 h in 4% paraformaldehyde (PFA) (Thermoscientific, 043368.9 M) in phosphate-buffered saline (PBS) at 4 °C with gentle rotation. After three washes in PBS for 10 min each, the organs were stored overnight in 30% sucrose (Sigma) in PBS. The organs were then embedded in optimal cutting temperature coumpound (Sakura) and frozen at −80 °C. The cryosections (35 µm) were cut on a cryostat (Leica), washed three times for 10 min each in PBS and blocked and permeabilized in PBS containing 10% donkey serum (Millipore), 10% fetal bovine serum (FBS) and 1% Triton X-100. The primary antibodies (Supplementary Table 2) were diluted in the same buffer and incubated with sections overnight at 4 °C. This step was followed by three 10 min washes in PBS and incubation for 2 h with conjugated secondary antibodies (Supplementary Table 2) and 4,6-diamidino-2-phenylindole (DAPI) in PBS at room temperature. After three washes in PBS, the sections were mounted with Fluoromount-G (SouthernBiotech). To detect the DLL4 protein, we had to use streptavidin/tyramide-based signal amplification. Briefly, BLOXALL endogenous blocking solution (Vector Laboratories, SP-6000) was used to quench endogenous peroxidase activity. After adding the primary goat anti-Dll4 and secondary antibody biotin-donkey anti-goat (as mentioned above), the slides were washed three times for 10 min in Tris-buffer with sodium and tween (TBST) (0.05 M Tris–HCl pH 7.5, 0.3 M NaCl and 0.1% Tween20) and then incubated with ABC reagent (Vectastain Elite ABC-HRP Kit, PK-6100) for 1 h at room temperature. After three washes with TBST buffer, the slides were incubated 3 min with tyramide signal amplification (TSA) fluorescein (PerkinElmer NEL701A) to amplify the signal.

Immunofluorescence on paraffin sections

The RBPJ protein was detected with the TSA kit (NEL701A) procedure in paraffin sections after antigen retrieval. In brief, the sections were dewaxed and rehydrated, followed by antigen retrieval in sub-boiling sodium citrate buffer (10 mM, pH 6.0) for 30 min. The slides were cooled down to room temperature for 30 min, followed by incubation for 10 min in BLOXALL Endogenous Blocking Solution (Vector Laboratories, SP-6000) to quench endogenous peroxidase activity. Next, the slides were washed twice for 5 min each in TBST buffer (0.3 M NaCl, 0.05 M Tris–HCl pH 7.5 and 0.1% Tween20), followed by blocking for 1 h in PBS containing 10% donkey serum, 10% FBS and 0.3% Triton. The sections were then incubated with primary antibodies (rat anti-RBPj, rabbit anti-RFP-594 and goat anti-GFP (green fluorescent protein); Supplementary Table 2) at 4 °C in TBST buffer containing 5% donkey serum and 1% FBS. The slides were washed three times for 10 min in TBST buffer and then incubated for 1 h at room temperature with biotin-SP-donkey anti-rat and donkey anti-goat AF680 antibodies. The slides were washed three times for 10 min in TBST buffer and then incubated with ABC reagent (Vectastain Elite ABC-HRP Kit, PK-6100) for 1 h at room temperature. After three washes with TBST buffer, the slides were incubated for 3 min with TSA fluorescein (PerkinElmer NEL701A). The slides were then washed three times for 10 min in TBST buffer and stained with DAPI before mounting with Fluoromount-G (SouthernBiotech).

Whole-mount immunofluorescence of retinas

For postnatal mouse retina immunostaining, eyes were collected and fixed in ice-cold 4% PFA in PBS for 10 min. The eyes were then incubated in the same solution for a further 15 min at room temperature, washed once in PBS and kept on ice. After microdissection with spring scissors (FST), the retinas were fixed in 4% PFA for an additional 45 min at room temperature, followed by two PBS washes of 10 min each. The retinas were blocked and permeabilized for 1 h in PBTS buffer (0.3% Triton X-100, 3% FBS and 3% donkey serum). The samples were then incubated overnight at 4 °C with biotinylated isolectin B4 (Vector Labs, B-1205, diluted 1:50) and primary antibodies (Supplementary Table 2) diluted in PBTS buffer. After five washes (20 min each) in PBTS buffer diluted 1:2, the samples were incubated for 2 h at room temperature with Alexa-conjugated secondary antibodies (Supplementary Table 2). After three washes of 30 min each in PBTS buffer (diluted 1:2) and two washes of 15 min each in PBS, the retinas were mounted with Fluoromount-G (SouthernBiotech).

In vivo EdU labeling and detection of EC proliferation

To detect EC proliferation in postnatal liver and pancreas, 20 μg g⁻¹ body weight EdU (Invitrogen, A10044) was injected intraperitoneally into P1, P7 or P20 mice 4 h before dissection. Livers and pancreases were fixed in 4% PFA and processed for cryosectioning as described above. The EdU signals were detected with the Click-it EdU Alexa Fluor 647 or 488 Imaging Kit (Invitrogen, C10340 or C10337). In brief, after all other primary and secondary antibody incubations, the samples were washed according to the immunofluorescence staining procedure and then incubated with Click-iT EdU reaction cocktail for 40 min, followed by DAPI counterstaining.

Isolation of lung fibroblasts from adult mice

To establish primary cell cultures of lung fibroblasts we followed a published protocol⁴⁰, with some modifications. Briefly, lungs were dissected from mice under sterile conditions and placed in sterile PBS. In a cell culture hood, the lungs were removed from PBS and then chopped into small fragments with scissors and placed in 10 ml of digestion buffer containing Dulbecco’s phosphate-buffered saline (DPBS, Thermofisher 14040141) with Liberase TL (0.14 Wunsch units per milliliters; Merck 5401020001) and 1× antibiotic/antimycotic (Thermofisher 15240096). The tissue in digestion buffer was incubated in a water bath at 37 °C for 30 min, with mixing every 2–3 min. After this period, the solution was pipetted up and down to break clumps and after 10 ml of culture medium containing DMEM buffer/F12 (Thermofisher 11320033), 15% FBS and 2× antibiotic/antimycotic solution was added. This cell suspension was centrifuged at 500g for 5 min. The cell pellet was washed two times with culture medium to remove liberase completely. At the end, the cells were resuspended in 12 ml of culture medium and seeded in a p100 dish and incubated at 37 °C, 5% CO₂ and 3% O₂. The medium was changed after 3–5 days, when fibroblasts had crawled out of tissue fragments. The fibroblasts were then expanded and maintained in full medium at 37 °C, 5% CO₂ and 3% O₂ for expansion and only transferred to normoxic conditions to carry out experiments.

To induce recombination, the cells were trypsinized, resuspended and plated in culture medium containing 0.2 μM of 4-OH tamoxifen for 4 h and washed after in culture medium. The cells were then trypsinized at different timepoints after induction (24, 48, 72, 96 and 120 h), stained with DAPI and analyzed or sorted in a FACS machine. A minimum of 20,000 cells per experimental group were sorted into 300 μl of a solution containing DPBS and 10% FBS. At the end, the cells were centrifuged at 500g for 5 min at 4 °C, and the supernatants removed. The cell pellets were stored at −80 °C until all the samples were ready to be further processed. Genomic DNA was extracted from cell pellets by incubating each pellet in 40 μl of DirectPCR Lysis Reagent (Viagen 301-C) supplemented with proteinase K (0.33 mg ml⁻¹) and incubated at 55 °C overnight. Proteinase K was inactivated by incubating samples at 85 °C for 45 min. A total of 1 μl of each sample was directly used for quantitative real-time PCR (qRT-PCR) using Taqman universal master mix and an Applied Biosystems QuantStudio5 machine.

Derivation and live imaging of mouse embryonic stem cells

To derive genetically modified mouse ES cells, we intercrossed mice containing the desired alleles, and the pluripotent cells unit at CNIC (centro nacional de investigaciones cardiovasculares) expanded in vitro their blastocysts according to established protocols⁴¹. Briefly, the blastocysts were transferred individually to a 24-well plate containing feeder layers of freshly inactivated MEFs and in ES-2i medium (DMEM/Glutamax, GIBCO 31966-021; NEAA, β-mercaptoethanol, LIF, 20% serum replacement, 3 µM CHIR and 1 µM PD). The blastocysts were cultured without disturbance for 3 days. From day 4, the medium was changed every other day, and when each embryo inner cell mass had grown sufficiently, it was disaggregated by gently trypsinization and individually passaged to a new 24-well plate. Following several passages, the independent cell lines were genotyped, expanded and frozen. A selected ES clone carrying the alleles CAG-FlpO-ERT2, iDre/Flp^Progenitor and R26-iFlp^{MTomato-Cre/MYFP} was plated on matrigel and induced with 1 μM of 4-OHT for 3 h and incubated for 22 h more with ES-2i medium. The antibody hCD2-APC was added 2 h before starting the time-lapse live imaging (24 h after 4-OHT induction) on a Leica SP8 Navigator with a chamber set at 37 C and 5% CO₂.

Image acquisition and analysis

For confocal scanning, the immunostained organ sections or whole-mount retinas were imaged at high resolution with a Leica SP8 Navigator confocal microscope fitted with a 10×, 20× or 40× objective. The individual fields or tiles of large areas were acquired. All the images shown are representative of the results obtained for each group and experiment. The animals were dissected and processed under exactly the same conditions. Comparisons of phenotypes or signal intensities were made using images obtained with the same laser excitation and confocal scanner detection settings. ImageJ/FIJI v1.53c was used to threshold, select and quantify the objects in confocal micrographs. Manual and automatic ImageJ public plugins and custom-made Fiji macros (file ‘Script_Reporter_Marker detection_FINAL.ijm’ for quantifying ERG (EC nuclei marker) or DAPI colocalization with reporters and other markers; Figs. 1e–k, 2f–h and 3e and Extended Data Figs. 1d, 3d, 4 and 6c,d) and R scripts were used for quantification: ‘Script_PostnatalLiver_CloneOutput’ (for postnatal liver clonality analysis; Fig. 4b,e), ‘Script_PostnatalPancreas_CloneOutput’ (for postnatal pancreas clonality analysis; Fig. 4g–i), ‘Script_AdultLiver_CloneOutput’ (for adult liver clonality analysis; Fig. 4k–p and Extended Data Fig. 6e) and ‘RMacroForClustering_iProgenitor’ (for clustering analysis of iProgenitor mouse line; Extended Data Fig. 7b,c). Adobe Photoshop CC 19.1.5 and Adobe Illustrator CC v22.1 were used for downstream image processing, analysis and illustration.

FACS and sorting

Embryonic, postnatal or adult tissues were dissociated before FACS. The embryonic tissues were dissociated using the Miltenyi Biotec Tissue Dissociation Kit 2 (130-110-203). Postnatal and adult mouse tissues were first digested for 20 min at 37 °C with 2.5 mg ml⁻¹ collagenase type I (Thermofisher), 2.5 mg ml⁻¹ dispase II (Thermofisher) and 50 μg ml⁻¹ DNAseI (Roche).

The dissociated samples were filtered through a 70 μm cell strainer, and the cells were centrifuged (400g, 4 °C for 5 min). The cell pellets were gently resuspended in blood lysis buffer (0.15 M NH₄Cl, 0.01 M KHCO₃ and 0.01 M EDTA buffer in distilled water) and incubated for 10 min on ice to remove erythroid cells. The cells were centrifuged (400g at, 4 °C for 5 min), and the cell pellets were gently resuspended in blocking solution (PBS without Ca²⁺ or Mg²⁺ and containing 3% dialyzed FBS (Termofisher)) and incubated at 4 °C with shaking for 20 min. The cells were centrifuged (300g at 4 °C for 5 min), resuspended and incubated for 30 min at 4 °C with APC rat anti-mouse CD31 and APC-CY7 anti-CD45 (Supplementary Table 2). The cells were then centrifuged (400g, 4 °C for 5 min), resuspended, washed in PBS without Ca²⁺ or Mg²⁺ and centrifuged again, and the cell pellets were resuspended in blocking solution. The cells were kept on ice until used for FACS. DAPI (5 mg ml⁻¹) was added to the cells immediately before analysis. The cells were routinely analyzed with a LSRFortessa cell analyzer or sorted in a FACS Aria Cell Sorter (BD Biosciences) (see Supplementary Fig. 2 for an example of the FACS gating strategy). BD FACS Diva V8.0.1 and Flow JO v10 were utilized for FACS data collection and analysis.

Cell isolation for transcriptomic analysis

For qRT-PCR analysis, approximately 20,000 DAPI-negative MTomato⁺ or MYFP⁺ cells from dissociated tissues were sorted directly to RLT buffer (RNAeasy Micro kit, Qiagen), and RNA was extracted according to the manufacturer’s instructions and stored at −80 °C. This RNA was later used for qRT-PCR or RNA sequencing analysis. For qRT-PCR, the total RNA was retrotranscribed with the High Capacity cDNA Reverse Transcription Kit with RNase Inhibitor (Thermo fisher, 4368814). Complementary DNA (cDNA) was preamplified with Taqman PreAmp Master Mix containing a Taqman Assay-based preamplification pool composed of a mix of the Taqman assays indicated in Supplementary Table 3. The preamplified cDNA was used for qRT-PCR using the same gene-specific Taqman Assays and Taqman Universal Master Mix in an AB7900 thermocycler (Applied Biosystems). The data were retrieved and analyzed with AB7900 software.

For RNA-seq analysis (Fig. 6), the embryos were dissociated using Miltenyi Biotec Tissue Dissociation Kit 2 (130-110-203). A 1.2 ml volume of dissociation solution was placed together with a single embryo in a 2 ml round-bottom tube. Following a 5 min incubation in a 37 °C water bath, the tubes were placed inside a prewarmed 50 ml falcon tube and incubated for 25 min on a MACSmix Tube Rotor. The cells were then resuspended with 30 strokes with a Gilson P1000 pipette, starting slow and increasing speed gradually. To the 1.2 ml cell suspension 3 ml of sorting buffer was added (10% FBS in Ca₂– and Mg₂-free PBS), and the resulting solution was transferred to a 5 ml syringe. This volume was pressed slowly through a small 70 µm strainer to remove clumps. Each embryo yielded around 30 million cells at this stage and was processed independently. The cell suspensions were spun at 400g for 6 min, and the pellets were detached and resuspended in 300 µl sorting buffer containing DAPI. DAPI-negative, single and live MTomato⁺ and MYFP⁺ cells were sorted to eppendorf tubes containing 300 µl of sorting buffer. A total of 66,000 MTomato⁺ cells and 30,000 MYFP⁺ cells were sorted using a 100 µm nozzle, 20 PSI, and high purity scale and relatively low flow rate (less than 3,000 events per second) to preserve cell viability and decrease contamination. The sorted cells were spun at 500g for 5 min and resuspended in 30–40 µL cell-capture buffer (Ca₂– and Mg₂-free PBS supplemented with 0.04% bovine serum albumin). After counting the cells in a Countess 3 Automated Cell Counter (Thermo Fisher Scientific), two independent 10x Genomics ports were loaded with either 16,000 MTomato⁺ cells (90% viability) or 16,000 MYFP⁺ cells (88% viability).

Next-generation sequencing sample and library preparation

Next-generation sequencing experiments were performed in the CNIC Genomics Unit. For scRNA-seq experiments, the single cells were encapsulated in emulsion droplets using the Chromium Controller instrument (10x Genomics). scRNA-seq libraries were prepared according to the manufacturer’s instructions. The aimed target cell recovery for each port was 10,000 cells. The generated libraries were sequenced in a HiSeq4000 or NextSeq2000 system (Illumina).

Transcriptomic data analysis

Transcriptomic data were analyzed by the CNIC Bioinformatics Unit, Alvaro Regano and Irene Garcia.

The following pipeline was followed for scRNA-seq data processing and in silico cell-type selection. For alignment and quantification of gene expression, the reference transcriptome was built using mouse genome GRCm38 and Ensembl gene build v98 (sep2019.archive.ensembl.org). The WPRE-sv40pa sequences expressed in the MTomato⁺ and MYFP⁺ samples were added to the reference. The gene metadata were obtained from the corresponding Ensembl BioMart archive. The reads from transcripts were processed, aligned and quantified using the Cell Ranger v6.1.2 for the Rbpj wild-type versus KO samples and Cell Ranger v7.1.0 for the Notch1/2/3 wild-type versus KO samples. The single-cell analysis was based on the Seurat v4.1.3 (https://satijalab.org/seurat/)⁴² and DoubletFinder R packages. Low-quality cells were filtered out using the following criteria: total counts, >1,000 and <55,000; genes detected, >500 and <7,500; mitochondrial transcripts content, <15%; hemoglobin transcripts, <1%; and ribosomal transcripts, <35. The counts were log-normalized and scaled, followed by a principal component analysis and clustering using the shared nearest-neighbors algorithm and Louvain clustering (settings as defaults except for the 2,000 most variable genes, 24 principal components and a resolution of 0.35). The clusters and cells were classified on the basis of the SingleR function from the SingleR package (v2.0)⁴³. Spearman correlation coefficients with an 80th percentile threshold were taken into consideration for correct cell type assignment using the following three datasets as reference for the label transfer: Blueprint ENCODE, the Human Primary Cell Atlas cell-type profile collection⁴³ and a scRNA-seq mouse dataset from the celldex package (https://bioconductor.org/packages/release/data/experiment/vignettes/celldex/inst/doc/userguide.html). This identification was used to predefine the different cell types present in the dataset for the analysis. The doublets were removed using DoubletFinder, using a first annotation with 24 PCs (principal components), number of artificial doublets (pN) 0.25 and a neighbourhood size (pK) of 0.05, and the second annotation with 10 PCs, pN 0.25 and pK 0.05. The cells classified as singlets were preserved. The singlets were then reclustered using 19 principal component analyses and a clustering resolution of 0.35. A manual curation of the identified clusters was applied to confirm and finetune the identity of the clusters based on available scRNA-seq bibliography^44,45. R scripts used to analyze RNA sequencing data, ‘Script_Embryos_Jan2023’ and ‘ToGenerateGraphsOnly’ (Fig. 6 and Extended Data Figs. 8–10), are available at GitHub (https://github.com/RuiBenedito/Benedito_Lab/tree/main/iFlpMosaics).

To evaluate the rate of exon deletion (for Rbpj, Notch1, Notch2 and Notch3) in scRNA-seq data obtained from the different iFlpMosaic experiments (Fig. 6), we evaluated the number of reads with unique molecule identifiers aligning with each of the exons (included the deleted/floxed exons) and the last 3’ exon–UTR sequence, the latter usually overrepresented in 3′ mRNA 10x Chromium sequencing data. A valid cell barcode, unique molecule identifier and compatible strand was considered in the quantification. The exon read data were incorporated into the Seurat object as metadata and normalized to the total RNA counts per cell. If more than one exon was flanked by loxP sites, the sum of their reads was aggregated as a single variable to quantify the deletion. Subsequently, we visualized the data using a dot plot analysis showing the percentage of cells and average expression of the whole mRNA (which includes the last 3′ UTR exon that is overrepresented) or the specific gene floxed exons, expected to be deleted by Cre in MTomato⁺ (mutant) cells.

Copy number assays

To determine the copy number of FlpO– or Cre-expressing cassettes after transgenesis, genomic DNA was extracted from mouse tail biopsies. Briefly, the blood samples were digested overnight in 500 μl proteinase K solution (10 mM Tris–HCl (pH 8.0), 100 mM NaCl, 10 mM EDTA (pH 8.0), 0.5% sodium dodecyl sulfate and 0.25 mg ml⁻¹ proteinase K) with occasional vortexing. To this solution, 250 μl each of phenol and chloroform was added, followed by vigorous vortexing to ensure thorough mixing. The samples were immediately microcentrifuged at maximum speed for 5 min to separate the aqueous and organic layers. The upper aqueous layer (300 μl) was removed, with special care taken not to disturb the interface. To 300 μl solution, 30 μl (0.1× volume) of 3 M NaAc and 825 μl (2.5× volume) of 100% EtOH were added. The tubes were then shaken ten times to precipitate the DNA. The samples were spun down at maximum speed for at least 45 min at 4 °C. The supernatant was removed and pelleted DNA was washed with 500 μl 70% ethanol, followed by centrifuging at max speed for 5 min. The washed pellets were resuspended overnight in 100 μl Tris-EDTA solution (Tris 10 mM and 0.1 mM EDTA, pH 8). The next day, the DNA concentrations were measured in a NanoDrop microvolume spectrophotometer (Thermo Fisher Scientific) and diluted to a final concentration of 10 ng μl⁻¹.

For the copy number assays, we performed qRT-PCR with TaqMan Universal Master Mix (TaqMan, 4440049) and the following probes: Tert TaqMan Copy Number Reference Assay (TaqMan probe, 4458369, with dye VIC: 2′-chloro-7′-phenyl-1,4-dichloro-6-carboxyfluorescein), and probes and primer sets with the fluorophore fluorescein amidite (FAM) designed in the lab and synthetized by integrated DNA technologies (idtdna.com). To detect FlpO (qPCR FlpO probe: TCTTGATGTCGCTGAACCTGCCG with primers FlpO-qPCR-F: CTGTACCAGTTCCTGTTCCTG and FlpO-qPCR-R: CTTGTCTTGGTCTCGGTCAC) and a predesigned Cre assay to detect the Cre gene (Mr00635245_cn, ThermoFisher).

The relative number of copies of the genes of interest was determined using the Tert probe as a reference. The Tert and FlpO/Cre probes were combined in the same reaction since they emit different fluorophores, VIC and FAM, respectively. The qRT-PCR reactions were run in an AB7900 thermocycler (Applied Biosystems).

Statistics and reproducibility

The numerical data was first processed with Microsoft Excel 2016 and after analyzed and plotted with Graphpad Prism v7.03. All bar graphs show mean ± standard deviation. The experiments were repeated with independent animals, as stated in the source data file or figure legends. The comparisons between two sample groups with a Gaussian distribution were by unpaired two-tailed Student t-tests. The comparisons among more than two groups were by one-way analysis of variance followed by multiple comparison tests. Datapoints were analyzed and plotted with GraphPad Prism. No randomization or blinding was used, and the animals or tissues were selected for analysis based on their genotype, the detected Cre/FlpO/Dre-dependent recombination frequency and the quality of multiplex immunostaining. The sample sizes were chosen according to the observed statistical variation and published protocols.

Reporting summary

Further information on research design is available in the Nature Portfolio Reporting Summary linked to this article.

• SEO Powered Content & PR Distribution. Get Amplified Today.
• PlatoData.Network Vertical Generative Ai. Empower Yourself. Access Here.
• PlatoAiStream. Web3 Intelligence. Knowledge Amplified. Access Here.
• PlatoESG. Carbon, CleanTech, Energy, Environment, Solar, Waste Management. Access Here.
• PlatoHealth. Biotech and Clinical Trials Intelligence. Access Here.
• Source: https://www.nature.com/articles/s41592-024-02534-w