Stem Cell

Generation of antigen-specific mature T cells from RAG1−/−RAG2−/−B2M−/− stem cells by engineering their microenvironment – Nature Biomedical Engineering

Time Stamp: December 6, 2023 7:00 PM
Source Node: 373462

Cell lines

The MS5-hDLL4 cell line was generated in our laboratory as previously described¹². For clarity, we reproduce the following description from ref. ¹². Briefly, MS5 cells⁴⁵ were transduced with a lentiviral vector encoding full-length hDLL4. The highest 5% of DLL4-expressing cells were isolated by fluorescence-activated cell sorting (FACS) using an anti-hDLL4 antibody and passaged in DMEM with 10% fetal calf serum (FCS). Stable expression was confirmed by flow cytometry for hDLL4 expression after several weeks of culture, along with quantitative RT-PCR and RNA sequencing.

For the cell lines including class I MHC and scaffolding proteins, the previously derived MS5-hDLL4 line was transduced with varying combinations of individual lentiviruses encoding human HLA-A*02:01, hB2M and human ICAM1 (hICAM1). The highest 5% of transduced cells were isolated by FACS using antibodies detecting HLA-A*02:01, hB2M and hICAM1, and then passaged in DMEM with 10% FCS for expansion and cryopreservation. Stable expression was also confirmed by flow cytometry for hDLL4, HLA-A*02:01, hB2M and hICAM1.

aAPCs were generated in our laboratory as previously described¹². For clarity, we reproduce the following description from ref. ¹². K562 cells (catalogue number CCL-243; ATCC) were transduced with lentiviral vectors encoding full-length human CD80, CD83, CD137L and HLA-A*02:01-B2M-NYESO_157–165 SCT (gifts from David Baltimore; Caltech). Target cells for the cytotoxicity assay were created by transduction of K562 with either NYESO1 or MART1 SCTs.

Lentiviral vector packaging

The full-length coding sequences of hDLL4, human HLA-A*02:01, hB2M and hICAM1 were synthesized (Integrated DNA Technologies) and cloned into third-generation lentiviral vector backbone pCCL-c-MNDU3 (gift from Donald Kohn, University of California, Los Angeles (UCLA)). The mStrawberry fluorescence protein coding sequence was added downstream of HLA-A*02:01, separated by a furin-SGSG-2A linker for polycistronic expression.

The codon-optimized TCR V_α and V_β (including V_β13.1) chains of a TCR specific for HLA-A*02:01/NYESO_157–165 (derived from the 1G4 TCR²⁰) were previously described¹⁹ (gift from Antoni Ribas; UCLA). TCR coding sequences and the mTagBFP2 fluorescence protein⁴⁶, all separated by furin-SGSG-2A linkers, were subcloned into the third-generation pCCL lentiviral vector downstream of the ubiquitin C promoter with intron 1.

Packaging and concentration of lentivirus particles were performed as previously described¹¹. For clarity, we reproduce the following description from ref. ¹¹. Briefly, 293T cells (catalogue number CRL-3216; ATCC) were co-transfected with the lentiviral vector plasmids pCMV-DR8.9 and pCAGGS-VSVG using TransIT 293T (Mirus Bio) for 17 hours followed by treatment with 20 mM sodium butyrate for 8 hours, followed by generation of cell supernatants in serum-free UltraCulture for 48 hours. Supernatants were concentrated by ultrafiltration using Amicon Ultra-15 100K filters (EMD Millipore) at 4,000g for 40 min at 4 °C and stored as aliquots at −80 °C.

Human pluripotent cell lines

The human Embryonic Stem Cell Research Oversight Committee and Institutional Review Board have approved all protocols for the use of PSCs for this study. The human embryonic stem cell lines⁴⁷ (catalogue number WA01; WiCell) and ESI017 (ref. ⁴⁸) (catalogue number ES-700; ESI BIO) were maintained and expanded on Matrigel-coated 6-well plates (Growth Factor Reduced Matrigel Matrix; catalogue number 356231; BD Biosciences) in mTeSR Plus complete medium (mTeSR Plus Basal Medium and mTeSR 5X Supplement; catalogue number 100-0276; Stem Cell Technologies). Culture medium was changed daily. After reaching ~70% confluency, PSC cultures were dissociated with TrypLE Express (catalogue number 12604-013; Thermo Fisher Scientific) and seeded in single-cell suspension at a density of 2 × 10⁵ cells per well of a Matrigel-coated 6-well plate in mTeSR Plus complete medium and ROCK inhibitor Y-27632 dihydrochloride (10 µM; catalogue number 1254; Tocris Bioscience), which was removed from culture medium after 1 day.

Design and validation of CRISPR–Cas9 guide RNAs

Using published algorithms found on the Benchling web tool (https://benchling.com), 5 guide RNAs (gRNAs) with optimal in silico-predicted on- and off-target scores (out of 100) were designed to target sequences near the start of RAG1, RAG2 and B2M^{49,50,51,52,53,54}. On-target efficiency was assayed in vitro at each target locus by nucleofection of gRNA expressing pX459 plasmid (catalogue number 62988; Zhang Lab, MIT; Addgene) into K562 erythroleukemia cells (catalogue number CCL-243; ATCC).

Genomic DNA was collected from nucleofected cells, and the regions flanking the cleavage sites were amplified by PCR for RAG1 (693 bp; forward, 5′-TGTATACTGGGACCCTTGGGGAG-3′; reverse, 5′-AGAATTCCCACAGATGCGGCAGAG-3′), RAG2 (865 bp; forward, 5′-TCATCAGTGAGAAGCCTGGCTG-3′; reverse, 5′-GTCACGGCTTTTGTAACCTCGG-3′) and B2M (644 bp; forward, 5′-TGAAGTCCTAGAATGAGCGCCC-3′; reverse, 5′-TAAACTTTGTCCCGACCCTCCC-3′). Products were purified and on-target CRISPR–Cas9 cutting efficiency was determined by Sanger sequencing of the PCR products using the Tracking of Indels by Decomposition (TIDE) tool⁵⁵. The percentage of edited cells was calculated based on the indels produced as a result of double-stranded breaks from CRISPR–Cas9.

For each gene target, the two gRNA candidates with the highest on-target in vitro cutting activity were chosen for off-target cleavage activity in vitro via the genome-wide, unbiased identification of double-stranded breaks enabled by sequencing (GUIDE-seq) method⁵⁶. One gRNA with high on- and low off-target cutting activity was chosen for each target gene to proceed with editing in PSC lines.

Gene editing of human PSC lines

CRISPR–Cas9 gene editing of PSCs was performed with ribonucleoprotein (RNP) complexes⁵⁷ of purified spCas9-NLS (QB3 MacroLab, University of California, Berkeley) and custom-synthesized sgRNAs (Synthego). spCas9-NLS and gRNAs were stored at −80 °C before use for gene editing of PSCs.

Briefly, PSCs were allowed to grow in wells of a Matrigel-coated 6-well plate until reaching ~70% confluency before being dissociated with TrypLE Express (catalogue number 12604-013; Thermo Fisher Scientific) and resuspended in single-cell solution. Before nucleofection, 84 pmol of each gRNA was complexed with 60 pmol of spCas9, individually, at a ratio of 1 pmol spCas9 to 1.4 pmol gRNA for 15 min at room temperature. PSCs were resuspended at a concentration of 2 × 10⁵ cells in 14 µl of P4 Primary Cell Nucleofector Solution (P4 Primary Cell 4D-Nucleofector X Kit S, catalogue number V4XP-4032; Lonza).

For sgRNA reactions, fully complexed RNPs (60 pmol spCas9:84 pmol gRNA) were added to resuspended cells and the volume was brought up to 20 µl using P4 Primary Cell Nucleofector Solution (Lonza). For dual gRNA reactions, RNPs were complexed individually and then added (2× 60 pmol spCas9 total) into the cell suspension with a custom-synthesized single-stranded oligonucleotide donor template (ssODN, 100 bp, resuspended at 100 µM; Ultramer DNA Oligo; Integrated DNA Technologies) to a final concentration of 3 µM in solution. Twenty microlitres of combined PSC, RNP and/or ssODN solutions were added into individual wells of the 16-well Nucleocuvette Strip (Lonza). Nucleofection was performed on the 4D-Nucleofector Core and X Unit (catalogue numbers AAF1003B and AAF-1003X; Lonza) using pulse and frequency code CB-150. Cells were allowed to rest in the cuvette for 10 min before transferring into 1.5 ml mTeSR Plus and ROCK inhibitor Y-27632 dihydrochloride (10 µM), and then plated in 1 well of a Matrigel-coated 12-well plate. Culture medium was changed daily, and ROCK inhibitor Y-27632 dihydrochloride (10 µM) was removed from the medium after 48 hours. Edited PSCs were allowed to reach ~70% confluency before being expanded for single-cell cloning and cryopreservation.

KO of RAG1 and RAG2 in both H1 and ESI017 parent lines was achieved using a gene-ablation strategy that excised the ~30 kb region on chromosome 11 in which their coding regions were located using both RAG1 CRISPR number 4 and RAG2 CRISPR number 14 gRNAs (Supplementary Fig. 1c,d), and a 100 bp ssODN homology-directed repair template (5′-TTTTCATTGTTCTCAGGTACCTCAGCCAGCATGGCAGCCTCTTTCCCAC CCCCTGGTATTGCTGGAGCCTCTCCTGGGGACTTTTGAACAGGTGACCCGA-3′) (Supplementary Fig. 1g). Complete ablation of RAG1 and RAG2 genes was confirmed by PCR amplification of a 693 bp sequence within the excised region in PSC clones (RAG PCR number 1, forward, 5′-TGTATACTGGGACCCTTGGGGAG-3′; reverse, 5′-AGAATTCCCACAGATGCGGCAGAG-3′); proper re-joining of the chromosomal ends was confirmed with PCR amplification of a novel 609 bp product using primers that targeted sequences outside of the ~30 kb region excised by gene editing in PSC clones (RAG PCR number 2, forward, 5′-TGTATACTGGGACCCTTGGGGAG-3′; reverse, 5′-GTCACGGCTTTTGTAACCTCGG-3′) (Supplementary Fig. 1g,h). KO of B2M in DKO lines was achieved by introducing indels at the beginning of its coding sequence (exon 1 with B2M gRNA number 3), and polyclonal KO lines were purified via FACS (Supplementary Fig. 4c–f).

Single-cell cloning of edited human PSC lines

Single-cell cloning was achieved with low-density plating of expanded, edited PSCs⁵⁴. Briefly, expanded, edited PSCs were dissociated into single-cell solution with TrypLE Express (catalogue number 12604-013; Thermo Fisher Scientific) and then plated in Matrigel-coated 10 cm dishes at a density of 0.5–1 × 10⁴ cells per plate in mTeSR Plus complete culture medium with ROCK inhibitor Y-27632 dihydrochloride (10 µM). Culture medium was changed daily, and ROCK inhibitor Y-27632 dihydrochloride (10 µM) was removed from the medium after 48 hours. After colony formation, 24–48 individual colonies were scraped with a 200 µl ‘P200’ pipette tip under a microscope, and then they were transferred into individual wells of a Matrigel-coated 12-well plate with mTeSR Plus culture medium. Once cells reached 60–80% confluency, cells were passaged via scraping for expansion and genotyping PCRs to determine bi-allelic KO of edited genes. Clones with bi-allelic KOs were expanded, cleaned for differentiation, and then genotyped once again before cryopreservation and karyotyping.

Transduction of human PSC lines

NYESO TCR-transduced PSC lines were generated by transduction of unedited or KO H1 or ESI017 PSCs with either lentiviral vectors encoding the 1G4 TCR (HLAA*02:01 restricted recognizing NYESO_157–165 peptide) or the F5 TCR (HLA-A*02:01 restricted recognizing MART1_26–35 peptide) and the fluorescence marker mTagBFP2. Briefly, PSCs were dissociated into single-cell suspension and plated at a density of 2 × 10⁵ cells per well of a Matrigel-coated 6-well plate in mTeSR Plus culture medium with ROCK inhibitor Y-27632 dihydrochloride (10 µM). The following day, the culture medium was changed to 1 ml of mTeSR, and concentrated lentiviral supernatant was added directly into the wells. The medium was changed each day until cells reached ~70% confluency, when cells were dissociated with TypLE Express (catalogue number 12604-013; Thermo Fisher Scientific) and purified via FACS sorting using the phenotype TRA1-81⁺mTagBFP2⁺. Isolated cells were returned to culture on Matrigel-coated 6-well plates and mTeSR Plus culture medium for expansion and cryopreservation.

Generation and isolation of human embryonic mesodermal progenitors

Mesodermal commitment was induced as previously described with certain optimizations^12,58,59. Briefly, PSCs were maintained as single-cell cultures on Matrigel-coated 6-well plates in mTeSR Plus complete medium. PSCs were collected as a single-cell suspension after treatment with TrypLE Express (catalogue number 12604-013; Thermo Fisher Scientific) for 6 min at 37 °C, washed and counted. Cells were resuspended directly in X-VIVO 15 medium (catalogue number 04-418Q; Lonza) supplemented with recombinant human (rh) activin A (10 ng ml⁻¹; catalogue number 338-AC-0101; R&D Systems), rhBMP4 (10 ng ml⁻¹; catalogue number 314-BP-010; R&D Systems), rhVEGF (10 ng ml⁻¹; catalogue number 298-VS-005; R&D Systems), rhFGF (10 ng ml⁻¹; catalogue number 233-FB-025; R&D Systems) and ROCK inhibitor Y-27632 dihydrochloride (10 µM; catalogue number 1254; Tocris Bioscience). Cells were plated on Matrigel-coated 6-well plates at 3.3 × 10⁶ cells per well in 3 ml. The medium was then changed daily with X-VIVO 15 supplemented with rhBMP4 (10 ng ml⁻¹), rhVEGF (10 ng ml⁻¹) and rhFGF (10 ng ml⁻¹). At day 3.5, cells were washed 3 times with PBS and incubated with Accutase (catalogue number AT-104; Innovative Cell Technologies): 1 ml per well for 10 min at 37 °C. Cells were collected by dilution with magnetic-activated cell sorting (MACS) buffer (PBS, 0.5% bovine serum albumin and 2 mM EDTA) followed by depletion of CD326⁺ (EpCAM) cells by MACS using CD326 (EpCAM) MicroBeads (catalogue number 130-061-101; Miltenyi). In addition, embryonic mesodermal progenitors (EMPs) derived from RAG1^−/−RAG2^−/−B2M⁻^/− TKO PSCs were stained with PE-conjugated hB2M antibody (BioLegend) and also depleted of B2M⁺ cells using MACS Anti-PE MicroBeads (catalogue number 130-048-801; Miltenyi) in addition to CD326 MicroBeads.

Human PSC-derived embryonic mesodermal organoid and ATO cultures

Embryonic mesodermal organoids (EMOs) and ATOs were generated as previously described¹². For clarity, we reproduce the following description from ref. ¹². Briefly, sequential generation of EMOs and then ATOs was accomplished in three-dimensional aggregates through changing media (Fig. 1a and Supplementary Fig. 2a). EMOs were established by aggregating purified EMPs with MS5-hDLL4 cells. MS5-hDLL4 cells were collected by trypsinization and resuspended in ‘haematopoietic induction media’ comprising EGM2 (catalogue number CC-4176; Lonza) supplemented with ROCK inhibitor Y-27632 dihydrochloride (10 µM; catalogue number 1254; Tocris Bioscience) and TGFβRI inhibitor SB-431542 (10 µM; SB Blocker, catalogue number 1614; Tocris Bioscience). At day −14, 5 × 10⁵ MS5-hDLL4 cells were combined with 5 × 10⁴ (H1) or 1 × 10⁵ (ESI017) purified EMPs per ATO in 1.5 ml Eppendorf tubes and centrifuged at 300g for 5 min at 4 °C in a swinging bucket centrifuge.

Multiple (up to 180) EMOs were prepared per tube. Supernatants were carefully removed and the cell pellet was briefly vortexed and resuspended in haematopoietic induction medium at a volume of 5 µl per EMO. Three EMOs were individually plated (5 µl per EMO) on a 0.4 mm Millicell transwell insert (catalogue number PIMC0R5G50; EMD Millipore) and then placed in a 6-well plate containing 1 ml of haematopoietic induction medium per well. The medium was changed every 2–3 days for 1 week with medium composed of EGM2 with SB Blocker (10 mM). At day −7, the medium was changed to EGM2 + SB Blocker (10 mM) with the haematopoietic cytokines, 5 ng ml⁻¹ rhTPO (catalogue number 288-TPN-025; R&D Systems), 5 ng ml⁻¹ rhFLT3L (catalogue number 308-FK-025; R&D Systems) and 50 ng ml⁻¹ rhSCF (catalogue number 255-SC-200; R&D Systems). This medium was changed every 2–3 days for an additional 7 days. At day 0, ATOs were initiated by simply changing to ATO culture medium (RB27) composed of RPMI 1640 (catalogue number 10-040-CV; Corning), 4% B27 supplement (catalogue number 17504044; Thermo Fisher Scientific), 30 mM l-ascorbic acid 2-phosphate sesquimagnesium salt hydrate (catalogue number A8960-5G; Sigma-Aldrich) reconstituted in PBS, 1% penicillin-streptomycin (catalogue number 15140122; Thermo Fisher Scientific), 1% Glutamax (catalogue number 35050061; Thermo Fisher Scientific), 10 ng ml⁻¹ rhSCF (R&D Systems), 5 ng ml⁻¹ rhFLT3L (R&D Systems) and 5 ng ml⁻¹ rhIL-7 (catalogue number 207-IL-200; R&D Systems). The medium was completely changed every 3–4 days.

For experiments involving the use of engineered stromal lines for ATO T cell differentiation (MS5-hDLL4-A*0201, MS5-hDLL4-A*0201-hB2M and MS5-hDLL4-A*0201-hB2M-ICAM), EMOs were collected in bulk after 14 days (day 0) by adding 1 ml MACS buffer (PBS, 0.5% bovine serum albumin and 2 mM EDTA) to each filter, briefly disaggregating the ATO by scraping with a 1 ml ‘P1000’ pipette and then passed through a 50 µm nylon strainer. Collected cells were counted, and then 2 × 10⁴ cells were combined with 2.5 × 10⁵ engineered MS5-hDLL4 stromal cell lines per ATO in 1.5 ml Eppendorf tubes. Cell mixtures were centrifuged at 300g for 5 min at 4 °C in a swinging bucket centrifuge before the formation of 3 ATO aggregates (5 µl per aggregate) per 0.4 mm Millicell transwell insert (catalogue number PIMC0R5G50; EMD Millipore), similarly to the EMO aggregate formation described above.

Isolation of ATO-derived SP8 and DP precursor cells

ATOs were collected by adding MACS buffer (PBS, 0.5% bovine serum albumin and 2 mM EDTA) to each filter, briefly disaggregating the ATO by pipetting with a 1 ml P1000 pipette, and then they were passed through a 50 µm nylon strainer; SP8 T cells were collected after 6 weeks of T cell differentiation, and DP precursors were collected after 3 weeks. For bulk-scale collection of ATOs, aggregates were collected in a similar fashion; however, up to 150 aggregates were collected in a well filled with MACS buffer and then they were transferred onto a 50 µm nylon filter, where aggregates were physically dissociated on top of the filter using the back end of a sterile 1 ml syringe. After dissociation, the filter was washed with MACS buffer and cell mixtures were centrifuged at 300g for 5 min at 4 °C in a swinging bucket centrifuge.

Stimulation and expansion of DP precursors

ATO-derived DP precursors were isolated as described above and seeded at an initial density of 5 × 10⁵ cells per well of a 48-well plate with 1 ml of specific culture medium described below. The activation and expansion of DP precursors using OKT3 antibody followed previously published protocols^25,26. DP precursors were isolated as described above and stimulated with 500 ng ml⁻¹ Ultra-LEAF Purified anti-human CD3 antibody (clone OKT3; BioLegend) and activated through CD3 engagement with Ultra-LEAF Purified anti-human CD3 antibody (catalogue number 317326; BioLegend) in MEMα (catalogue number 12561049; Thermo Fisher Scientific) supplemented with 15% FCS, 1% Glutamax (catalogue number 35050061; Thermo Fisher Scientific), 1% penicillin-streptomycin (catalogue number 15140122; Thermo Fisher Scientific), 1% Insulin-Transferrin-Selenium solution (catalogue number 41400045; Thermo Fisher Scientific) and 50 µg ml⁻¹ l-ascorbic acid 2-phosphate sesquimagnesium salt hydrate (Sigma-Aldrich) in the presence of 10 ng ml⁻¹ rhIL-7 (R&D Systems) and 10 nM dexamethasone (catalogue number D4902; Sigma-Aldrich) for 3 days before anti-human CD3 antibody and dexamethasone were removed. Expansion of T cells was carried out after 7 days for an additional 14 days (21 days total) in MEMα (catalogue number 12561049; Thermo Fisher Scientific) supplemented with 15% FCS, 1% Glutamax (catalogue number 35050061; Thermo Fisher Scientific), 1% penicillin-streptomycin (catalogue number 15140122; Thermo Fisher Scientific), 1% Insulin-Transferrin-Selenium solution (catalogue number 41400045; Thermo Fisher Scientific) and 50 µg ml⁻¹ l-ascorbic acid 2-phosphate sesquimagnesium salt hydrate (Sigma-Aldrich) in the presence of 10 ng ml⁻¹ rhIL-7 (R&D Systems), 5 ng ml⁻¹ rhIL-15 (catalogue number 247-ILB-025; R&D Systems) and 2 µg ml⁻¹ phytohaemagglutinin (catalogue number L1668-5MG; Sigma-Aldrich). For both activation and expansion stages, fresh medium was added every 2–3 days, and cells were replated into larger wells as necessary.

Activation and expansion of DP precursors was also performed using Dynabeads Human T-Activator CD3/CD28 (catalogue number 11131D; Thermo Fisher Scientific) according to the manufacturer’s protocol. Briefly, beads were added in a 1:1 ratio of T cells to beads in AIM V (catalogue number 12055083; Thermo Fisher Scientific) supplemented with 5% human AB serum (catalogue number 100-512; Gemini Bio-Products), 20 ng ml⁻¹ rhIL-2 (catalogue number 200-02; Peprotech) and 5 ng ml⁻¹ rhIL-7 (R&D Systems). Beads were replenished every 7 days, fresh medium was added every 2–3 days and cells were replated into larger wells as necessary.

Activation and expansion of DP precursors was also performed with irradiated antigen-expressing K562 aAPCs (K562 CD80-CD83-CD137L expressing either HLA-A*02:01-B2M-NYESO_157–165 SCT or HLA-A*02:01-B2M-MART1_26–35 SCT) in a 1:3 aAPC:T cell ratio in AIM V (Thermo Fisher Scientific) supplemented with 5% human AB serum (Gemini Bio-Products), 20 ng ml⁻¹ rhIL-2 (Peprotech) and 5 ng ml⁻¹ rhIL-7 (R&D Systems). Irradiated aAPCs were added every 7 days in a 1:3 aAPC:T cell ratio, fresh medium was added every 2–3 days and cells were replated into larger wells as necessary.

Single-cell RNA library preparation and sequencing

ATO-derived T cells were isolated as described above and then FACS sorted for ATO-derived SP8 T cells from WT (mCD29⁻CD45⁺CD8α⁺CD4⁻) and 1G4 TCR-transduced (mCD29⁻mTagBFP2⁺CD45⁺CD8α⁺CD4⁻) PSC ATOs into PBS + 0.04% bovine serum albumin. Cells were counted and resuspended at a concentration of ~1,000 cells per µl and provided to the Technology Center for Genomics and Bioinformatics (TCGB) core for unique molecular identifier (UMI) tagging and generation of gene expression (GEX) and human TCR repertoire (V(D)J) libraries using the 10X Chromium Next GEM Single Cell V(D)J Reagent Kit v.1.1 (10X Genomics). Similarly, PB SP8s were FACS isolated (CD45⁺CD8α⁺CD8β⁺CD4⁻TCRαβ⁺CD3⁺) from PB mononuclear cells obtained from healthy donors, and provided to the TCGB core for UMI tagging and library generation. Fully constructed libraries for all samples were run in one S4 flow cell on the Illumina NovaSeq Platform.

GEX and TCR reference genomes

The reference genomes used for GEX and TCR alignment, both of which correspond to the GRCh38 genome, were downloaded from the 10X Genomics website. To detect the exogenous TCR, which was expressed using a codon-optimized sequence, the GRCh38 reference genome was customized using the Cell Ranger v.7.0.0 (10X Genomics) ‘mkref’ pipeline.

scRNA-seq data filtration and cleaning

Sequenced reads from each sample were aligned to the human reference genome GRCh38 and filtered for empty droplets using the Cell Ranger v.7.0.0 (10X Genomics) ‘multi’ pipeline that generated count matrices from the GEX libraries and assembled full TCR contigs from the V(D)J libraries. On average, we achieved >30,000 mean reads per cell for GEX expression libraries and >7,000 mean reads per cell for V(D)J libraries.

For samples that were acquired for this study, GEX (RNA) count matrices were loaded with Seurat v.4.3.0 (Satija Lab)⁶⁰. As V(D)J libraries were also generated from the same complementary DNA, TCR genes aligned by whole transcriptomic sequencing were removed to prevent clustering bias from samples with intact germline TCR recombination. Count matrices were loaded separately and barcoded cells were filtered for cells with outlier UMI counts (low-quality cells and doublets), high mitochondrial gene expression (due to cellular stress or loss of cytoplasmic RNA) and low number of sequenced genes. After initial data filtration, individual datasets were bioinformatically cleaned for doublets using DoubletFinder v.2.0.3 (ref. ⁶¹), and cells were cleaned for stochastic dropouts of identity genes based on their sorted SP8 phenotype (CD8α, CD8β, CD3 > 0 and CD4 < 0). Cleaned cells were then batch corrected for technical and biological variations using the reciprocal principal component analysis (RPCA) integration method in Seurat. For integration of the combined ATO-derived SP8 T cell samples, molecular count data for each sample were individually normalized and variance stabilized using SCTransform in Seurat, and then cell cycle phase scores were calculated for each individual sample based on the expression of canonical cell cycle genes within a barcoded cell. Following cell cycle scoring, raw counts were normalized and variance was stabilized again using SCTransform in Seurat with the additional steps of regressing calculated cell cycle scores and mitochondrial genes to mitigate the effects of cell cycle heterogeneity and mitochondrial gene expression.

To perform RPCA integration of ATO-derived SP8 samples, highly variable genes (nfeatures = 5,000) were identified and then used to find integration anchors between datasets. Clustering of the fully integrated object of ATO-derived SP8 samples was performed using the IKAP (Identifying K mAjor cell Population group in scRNA-seq analysis) package⁶². IKAP analysis identified the optimal principal components and clusters for the dataset. Of the three clusters identified, one cluster was removed based on high mitochondrial gene expression, indicating stressed cells or loss of cytoplasmic RNA, and the other two were identified as immature (CD45RO⁺) and mature, naive (CD45RA⁺) SP8 T cells based on differentially expressed genes. Mature, naive CD45RA⁺ SP8 T cells were used for downstream analyses.

For publicly available datasets from human thymic SP8 (GSE148981; ref. ²⁷), PB NK and CD14⁺ monocyte (PB monocytes) cells (10X Genomics^28,29), raw sequencing reads were downloaded from their respective repositories and then aligned to the human reference genome GRCh38 using the Cell Ranger v.7.0.0 (10X Genomics) ‘count’ pipeline, similarly to method described above, which only generated count matrices from the GEX reads. Individual samples were loaded, filtered and cleaned using Seurat v.4.3.0 (Satija Lab), similarly to that described above. Total PB samples were SCTransform normalized in Seurat and variance stabilized before integration, and principal components were identified from the integrated object. Then, dimensional reduction (UMAP) and cell clustering was performed on the integrated object using the functions included in the Seurat package (Satija Lab). PB NK and CD14⁺ monocytes (PB monocytes) and PB SP8 T cells were identified and subset out of the integrated object for downstream analyses.

Analysis and visualization of scRNA-seq data

Cleaned samples were merged into a single Seurat (Satija Lab) object, preserving only the raw RNA count matrices for each object. Each sample was then normalized and variance stabilized using SCTransform in Seurat before regressing cell cycle phase scores and mitochondrial genes, as described above, before remerging the list back into a single object. Given the individual SCTransform models calculated from each sample, the minimum median UMI was used to recorrect the counts and data slot for downstream analysis using PrepSCTFindMarkers in Seurat (Satija Lab). Scaled expression values of highly variable genes, which were identified as the union of the top 5,000 genes from each individual sample during SCTransform in Seurat, were used to calculate principal component analysis for dimensionality reduction using the UMAP function in Seurat (Satija Lab). Individual cell populations (SP8, NK and monocytes) clustered together, and minor outliers were manually cleaned for gene expression visualization using the DotPlot function in Seurat (Satija Lab).

To perform global gene expression analysis between individual samples and their respective sources, a pseudobulk approach was taken by extracting the raw counts and metadata from the object, described above, and creating an object using the SingleCellExperiment package⁶³. Individual samples were assigned identities based on cell type identity and source to create a DEseq2 (ref. ⁶⁴) object in R, and pseudobulked counts were normalized using the regularized-logarithm transformation (rlog) function. Pearson’s correlations of global gene expression for all pairwise combinations between each sample were calculated from the rlog-normalized data using the cor() function in R v.4.2.1 (ref. ⁶⁵). Dendrogram and hierarchical clustering analysis were visualized using the pheatmap package⁶⁶.

For the purposes of analysing SP8 T cells without the addition of PB monocytes and PB NK cells, SP8 T cells were subset out of the object and each individual sample was normalized using SCTransform in Seurat and integrated using the RPCA integration method in Seurat with nfeatures = 5,000 highly variable genes. Clustering of the fully integrated object of ATO-derived SP8 samples was performed with the IKAP package⁶², which identified the optimal principal components and clusters for UMAP dimensionality reduction of the integrated object. Dendrogram, hierarchical clustering and global gene expression analyses were performed as described above.

TCR repertoire analysis by scRNA-seq

Full, endogenous TCR V_α and V_β contigs were aligned and assembled using the Cell Ranger v.7.0.0 (10X Genomics) multi pipeline, as described above. As the exogenous TCR was expressed using a codon-optimized sequence, reads from the 5′ GEX libraries were aligned using a custom human genome reference (GRCh38), described above, which included codon-optimized sequence for the 1G4 TCR. After full reconstruction of TCRs and gene alignment, Cell Ranger output matrices were filtered using Seurat v.4.3.0 (Satija Lab), as described above. For samples including the exogenous 1G4 TCR, barcoded cells were also extracted for cells that expressed the exogenous transgene. Finally, the remaining barcoded cells were exported as a list and used to filter V(D)J sequencing outputs in R for TCR diversity calculations, using the number of barcoded cells remaining after quality control as a denominator, and calculations of percentages of cells expressing endogenous and/or exogenous TCR.

Expansion of ATO-derived T cells for functional assays

ATO-derived SP8 T cells were isolated as described above and expanded in vitro using irradiated antigen-expressing K562 aAPCs (K562 CD80-CD83-CD137L and HLA-A*02:01-B2M-NYESO_157–165 SCT) in a 1:3 aAPC:T cell ratio in AIM V (Thermo Fisher Scientific) supplemented with 5% human AB serum (Gemini Bio-Products), 20 ng ml⁻¹ rhIL-2 (Peprotech) and 5 ng ml⁻¹ rhIL-7 (R&D Systems). Fresh medium was added every 2–3 days, and cells were replated into larger wells as necessary. Restimulations for proliferation assays were performed every 5 days. Before functional and proliferation assays, expanded SP8 T cells were rested for an additional 2 days after the previous expansion cycle (7 days from aAPC stimulation) with reduced cytokines, 5 ng ml⁻¹ rhIL-2 (Peprotech) only, on the night before the assays.

CFSE proliferation assays

As described above, SP8 T cells were expanded and rested before performing proliferation assays. Briefly, 5 × 10⁵ were labelled with CFSE (BioLegend) at a final concentration of 5 µM and co-cultured with irradiated K562 aAPCs expressing cognate (NYESO, HLA-A*02:01-B2M-NYESO_157–165) or irrelevant (MART1, HLA-A*02:01-B2M-MART1_26–35) SCTs at a 1:1 T cell:aAPC ratio in a 24-well plate and 3 ml AIM V (Thermo Fisher Scientific) with 5% human AB serum (Gemini Bio-products) and 20 ng ml⁻¹ rhIL-2 (Peprotech)¹². On day 5, cells were washed and stained for CD25 and 4-1BB (BioLegend) and analysed by flow cytometry.

T cell cytokine assays

Expanded SP8 T cells from ATOs were rested as described above. A total of 2 × 10⁵ rested ATO-derived SP8 T cells were co-cultured with K562 aAPCs expressing cognate (NYESO) or irrelevant (MART1) SCTs at a 2:1 T cell:aAPC ratio in 96-well U-bottom plates and 200 µl AIM V (Thermo Fisher Scientific) with 5% human AB serum (Gemini Bio-products) and protein transport inhibitor cocktail (catalogue number 00-4980-03; eBioscience) for 6 hours. After 4 hours, CD107α-APC antibody (BioLegend) was added to wells at a 1:50 final dilution. Cells were washed and stained for CD3, CD4 and CD8α (BioLegend) and Zombie NIR Fixable Viability Dye (BioLegend) before fixation and permeabilization with an intracellular staining buffer kit (catalogue number 88-8824-00; eBioscience) and intracellular staining with antibodies against IFNγ, TNFα and IL-2 (BioLegend).

In vitro cytotoxicity assays

Expanded SP8 T cells from ATOs were rested as described above. For cytotoxicity assays, 2-fold serial dilutions of rested SP8 T cells were performed in 96-well U-bottom plates starting at 1 × 10⁵ cells in 200 µl AIM V (Thermo Fisher Scientific) with 5% human AB serum (Gemini Bio-products). K562 aAPCs expressing cognate (NYESO) or irrelevant (MART1) SCTs were plated at 1 × 10⁵ target cells per well. Apoptotic cell death of target cells was quantified by Apotracker Green (BioLegend) and DAPI staining at 6 hours. Target cell death was calculated by subtracting the percentage of Apotracker Green-positive target cells in wells receiving no T cells from wells that received T cells.

In vivo tumour assay

All animal experiments were conducted under an ethics protocol approved by the UCLA Chancellor’s Animal Research Committee (protocol number ARC-2008-175). Female 6- to 8-week-old NOD.Cg-Prkdcscid Il2rgtm1Wjl/SzJ (NSG) mice (strain 005557, RRID IMSR_JAX:005557; Jackson Laboratory) were I.V. injected (tail vein) with 5 × 10⁵ NALM6 target cells transduced with the HLA-A*02:01-B2M-NYESO_157–165 SCT and firefly luciferase. In vivo imaging was performed by intraperitoneal injection of luciferin (IVIS spectrum; Perkin Elmer) 5 days after tumour injection. Groups of n = 9 mice were randomized based on average luciferase signal activity. ATO-derived SP8 T cells expressing NYESO TCR (1 × 10⁷ cells per mouse) were I.V. injected (retro-orbitally) after mice were grouped on day 5; control mice received PBS injections. Mice were dosed intraperitoneally with 10,000 IU rhIL-2 (catalogue number 202-IL-500; R&D Systems) on days 5–7 post-tumour injection, and then every 3 days until euthanasia was humane and necessary, as determined by our ethics committee. Tumour bioluminescence was repeated twice a week (every 3–4 days) for at least 26 days, and mice were euthanized based on disease burden criteria (Fig. 7a). Luminescence images were analysed using Living Image software v.4.7.4 (Perkin Elmer).

Flow cytometry and antibodies

Staining for flow cytometry was performed in PBS with 0.5% bovine serum albumin and 2 mM EDTA for 15 min at 4 °C in the dark. TruStain FcX (catalogue number 422302; BioLegend) was added to all samples for 5 min before antibody staining. Tetramer staining was performed with the PE-conjugated HLA-A*02:01/NYESO_157–165 tetramer (catalogue number TB-M011-1; MBL International) or PE-conjugated HLA-A*02:01/MART1_26–35 tetramer (catalogue number TB-0009-1; MBL International) at a 1:50 final dilution at room temperature for 20 min before additional antibody staining for 15 min at 4 °C. DAPI was added to all samples before analysis.

Analysis was performed on a BD LSRII Fortessa, and FACS sorting was performed on BD FACSAria or BD FACSAria-H instruments (BD Biosciences) at the UCLA Broad Stem Cell Research Center Flow Cytometry Core. BD instruments used BDFACSDiva software v.8.0.2 (BD Biosciences). For all analyses (except intracellular staining), DAPI-positive cells were gated out, and doublets were removed through forward scatter height versus forward scatter width and side scatter height versus side scatter width gating. The following anti-human antibody clones for surface and intracellular staining were obtained from BioLegend: CD3 (UCHT1), CD4 (RPA-T4), CD5 (UCHT2), CD7 (CD7-6B7), CD8α (SK1), CD25 (BC96), CD27 (O323), CD28 (CD28.2), CD326 (EpCAM; clone 9C4), CD34 (581), CD45 (HI30), CD45RA (HI100), CD45RO (UCHL1), CD56 (HCD56), CD62L (DREG-56), CD107α (H4A3), B2M (2M2), CCR7 (G043H7), HLA-ABC (W6/32), IFNγ (4S.B3), IL-2 (MQ1-17H12), TCRαβ (IP26), TNFα (MAb11), V_β13.1 (H131) and 4-1BB (clone 4B4-1). The anti-human antibody clone CD8β (clone REA715) was obtained from Miltenyi. Anti-mouse CD29 (clone HMb1-1) was obtained from BioLegend. Flow cytometry data were analysed with FlowJo software (Tree Star).

Statistics

In all figures, exact n values represent independent experiments and are specified in the figure legends, and mean ± s.e.m. values are shown. Statistics were analysed using GraphPad Prism software and P values were calculated using the two-tailed unpaired t-test, two-tailed Mann–Whitney U-test and the log-rank test. The P values are indicated directly on the figure within the corresponding graphs; *P < 0.05, **P < 0.01 and ***P < 0.001 were considered statistically significant.