Search
Close this search box.

Differential requirements for Smarca5 expression during hematopoietic stem cell commitment – Communications Biology

Mouse transgenesis

SMARCA5 cDNA fused to a C-terminal FLAG Tag (cleaved from MSCV2.2 vector) was cloned into NheI and SalI cleavage sites of the p15-6-20 DNA vector containing 5’ & 3’ homologies of Rosa26 and the tdTomato gene surrounded by LoxP sites, allowing excision of tdTomato and initiation of SMARCA5 transgene expression (Fig. 1a)22. The assembled transgenic vector (linearized by FseI) was nucleofected (Amaxa Nucleofector II instrument, program A-023, Lonza) into R1 ES cells (2 × 106) which were seeded on a layer of irradiated (35 Gy) mouse embryonic fibroblasts in recommended media (details below) supplemented with ESGRO (mLIF 1 kU/ml, cat. no. ESG1107, Merck, Darmstadt, Germany)23. G418-resistant colonies (200 μg/ml, cat. no. A1720, Sigma-Aldrich, Saint Louis, MO, USA) expressing tdTomato were selected and expanded. A 3.495 kbp PCR band (F: GTGTCTCTTTTCTGTTGGACCCTTACCT; R: AAAAAGAAGAAGGCATGAACATGGTTAG) verified integration of the transgene (Supplementary Fig. 1b). ES cells with a normal karyotype were injected into blastocysts and transferred into the uterus of superovulated C57BL/6NCrl females. Mice containing the Rosa26-S5tg construct were identified using PCR with the following primers Fwd: ACGAGGACCAAAGCCTTCAACAG, Rev: TGACAGTCGACAACTTCCTGACTAGGGAGTAGAAGT (Supplementary Fig. 1c). Germline transfer and backcrossing was performed into the C57BL/6NCrl strain. The progeny was viable, fertile and expressed tdTomato in all tissues. Mice expressing tdTomato with Cre-inducible SMARCA5 transgene were then crossed to three Cre expressing strains (hCD2 which is active from DN3 stage of thymocyte development and pro-B stage of B-cell development and CD2+ NK cells10,24, Vav1 promoting recombination in c-kit+(CD117+) definitive hematopoietic progenitors9, and constitutively expressed Gt(ROSA)26Sortm1(ACTB-cre,-EGFP)Ics 25) containing a conditional knockout allele of Smarca5 with loxP1 flanking (fl) exon 5 of the endogenous Smarca5 gene, resulting in a null allele upon Cre activation9,10.

All mice expressing Cre recombinase were hemizygous for specific Cre transgene. Mice were maintained in a controlled, specific pathogen-free environment. Mice were provided food and water ad libitum and kept in the animal facility with a 12-hour light-dark cycle. All experiments met the criteria approved by Czech Ministry of Agriculture and the Committee for Experimental Animals. We have complied with all relevant ethical regulations for animal use. In all experiments, we used mice of both sexes, age is indicated in figure legends.

ES cells culture medium

KnockOut™ DMEM (cat. no. 10829018, Gibco, Thermo Fisher Scientific, Waltham, Massachusetts, United States) supplemented with 15% KnockOut™ Serum Replacement (cat. no. 10828028, Gibco, Thermo Fisher Scientific, Waltham, Massachusetts, United States), 2 mM L-glutamine (cat. no. G7513, Sigma-Aldrich, St. Luis, MO, USA), 1x Penicillin-Streptomycin (cat. no. P0781, Sigma-Aldrich, St. Luis, MO, USA), 1x MEM Non-Essential Amino Acid Solution (cat. no. M7145, Sigma-Aldrich, St. Luis, MO, USA), 0,1 mM β-mercaptoethanol (cat. no. M3148, Sigma-Aldrich, St. Luis, MO, USA), ESGRO mLIF (1 kU/ml, cat. no. ESG1107, Merck, Darmstadt, Germany).

Tail tip DNA was genotyped with the following primers

S5tg-F: ACGAGGACCAAAGCCTTCAACACAG, R: TGACAGTCGACAACTTCCTGACTAGGGGAGGAGTAGAAGT (852 bp), S5fl-F: ACTGAGGACTCTGATGCAAACAGTCAAG, R: TACACAACTAAGGCAGTGGGTTATAGTGC (fl 614 bp, wt 524 bp), S5del-F: GTGCAAAGCCCAGAGACGATGGTATG (471 bp, with S5fl-rev), Cre-F: ACCAGGTTCGTTCACTCATGG, Cre-R: ACGGGCACTGTGTCCAGACC (449 bp), iCre-F: GATGCTCCTGTCTGTGTGCAG, iCre-R: CCTGCCAATGTGGATCAGC (469 bp).

Cell isolation and analysis

Single cell suspensions from peripheral blood, BM (isolated from 2 femurs and 2 tibias), thymus, and spleen were incubated on ice with specific primary antibodies in PBS + 1% biotin-free BSA solution for 20 min. Biotinylated primary antibodies were then visualized using streptavidin-conjugated fluorescent dyes. Cell suspensions were analyzed on BD LSRFortessaTM SORP (BD Biosciences, San Jose, CA, USA) or CytoFLEX (Beckman Coulter, Brea, CA, USA), and data analysis was performed using FlowJo software.

Antibodies for flow cytometry

Biotin anti-B220 (clone RA3-6B2; cat. no. 103204), FITC anti-B220 (clone RA3-6B2; cat. no. 103206), APC anti-CD4 (clone GK1.5; cat. no. 100412), BV421 anti-CD4 (clone GK1.5; cat. no. 100437), PE/Cy7 anti-CD5 (clone 53-7.3; cat. no. 100621), APC anti-CD8a (clone 53-6.7; cat. no. 100712), Biotin anti-CD11b/Mac-1 (clone M1/70; cat. no. 101204), BV421 anti-CD11b/Mac-1 (clone M1/70; cat. no. 101236), Biotin anti-CD11c (clone N418; cat. no. 117304), BV510 anti-CD16/32 (clone 93; cat. no. 101333), BV605 anti-CD25 (clone PC61; cat. no. 102036), PE anti-CD25 (clone PC61; cat. no. 102008), Biotin anti-CD34 (clone HM34; cat. no. 128604), APC anti-CD43 (clone S11; cat. no. 143208), FITC anti-CD44 (clone IM7; cat. no. 103006), PE/Cy7 anti-CD45 (clone 30-F11; cat. no. 103114), AF700 anti-CD45.1 (clone A20; cat. no. 110724), PE/Cy7 anti-CD45.2 (clone 104; cat. no. 109830), FITC anti-CD48 (clone HM48-1; cat. no. 103404), PE anti-CD71 (clone RI7217; cat. no. 113808), BV421 anti-CD117/c-Kit (clone 2B8; cat. no. 105828), BV786 anti-CD127/IL7Ra (clone A7R34; cat. no. 135037), APC anti-CD135/FLT3 (clone A2F10; cat. no. 135310), BV605 anti-CD150 (clone TC15-12F12.2; cat. no. 115927), Biotin anti-Gr-1 (clone RB6-8C5; cat. no. 108404), BV605 anti-Gr-1 (clone RB6-8C5; cat. no. 108440), Biotin anti-Nk1.1 (clone PK136; cat. no. 108704), PE anti-Nk1.1 (clone PK136; cat. no. 108708), FITC anti-Sca1 (clone D7; cat. no. 108106), PE anti-Sca1 (clone D7; cat. no. 108108), APC anti-Ter119 (clone Ter-119; cat. no. 116212), Biotin anti-Ter119 (clone Ter-119; cat. no. 116204), PerCP anti-Ter119 (clone Ter-119; cat. no. 116226), AF700 anti-mouse Lineage Cocktail with Isotype Ctrl (anti-CD3, clone 17A2; anti-Ly-6G/Ly-6C, clone RB6-8C5; anti-CD11b, clone M1/70; anti-CD45R/B220, clone RA3-6B2; anti-TER-119/Erythroid cells, clone Ter-119; cat. no. 133313), SV-PE/Cy7 (cat. no. 405206), SV-AF700 (cat. no. S21383; Life Technologies Corporation, Eugene, Oregon, USA). All antibodies supplied by BioLegend (San Diego, California, USA) with exception for SV-AF700.

Immunoblotting

Organs from 7–9-week-old mice were homogenized and lysed on ice for 30 min in isotonic lysis buffer (150 mM NaCl, 50 mM Tris-Cl pH 7.5, 0. 4% Triton-X, 2 mM CaCl2, 2 mM MgCl2, 1 mM EDTA, 5 mM NaF in dH2O), supplemented with 1 mM DTT, protease and phosphatase inhibitors and 25 U/µl of non-specific DNA nuclease (Benzonase; cat. no. SC-391121, Santa Cruz, CA, USA). Lysates were then mixed with SDS (final 1%) was heated for 5 min, 95 °C. Lysates were cleared by centrifugation (16 000 g, 4°C, 5 min) and protein concentration was determined by bicinchoninic acid assay (cat. No. 23228, Thermo Fisher, Waltham, MA, USA). 20 µg of protein was separated on a 4-20% SDS gradient of Mini-PROTEAN TGX Precast Protein gels and transferred with the Trans-Blot Turbo Transfer System to a PVDF membrane (all from Bio-Rad, Hercules, CA, USA). Membranes were blocked in 5% milk in TBS-T and incubated (overnight, 4 °C) in primary antibodies diluted in 3% BSA in TBS-T. After washing, membranes were incubated with horseradish peroxidase-conjugated anti-Rabbit IgG secondary antibody (1:10,000; Jackson ImmunoResearch, Cambridgeshire, UK; cat. no. 711-036-152) or with anti-Mouse IgG secondary antibody (1:10,000; Jackson ImmunoResearch, Cambridgeshire, UK; cat. no. 715-036-150). Primary antibodies: anti-SMARCA5 (1:1,000; Bethyl Laboratories, Montgomery, TX, USA; cat. no. A301-017A), anti-FLAG (1:1,000; Cell Signaling, Danvers, MA, USA; cat. no. 2368), anti-β-ACTIN (1:1,000; Abcam, Cambridgeshire, UK; cat. no. ab6276) and anti-GAPDH (1:1,000; Sigma-Aldrich, Saint Louis, MO, USA; cat. no. HPA040067). The binding efficiency of anti-SMARCA5 antibody with human and murine protein was tested using leukemia cell lines, specifically MEL (murine erythroleukemia) OCI-M2 (adult human acute myeloid leukemia) (Supplementary Fig. 1d). Visualization was performed using Pierce™ ECL Western Blotting Substrate (cat. no. PI32106, Thermo Fisher, Waltham, MA, USA) and detection using ChemiDoc Imaging System (Bio-Rad, Hercules, CA, USA). For densitometry all samples were normalized to their β-ACTIN/GAPDH loading control and the relative amount of protein was calculated compared to wild-type controls. 5. Uncropped and unedited blot images are available in Supplementary Fig. 6.

Hematopoietic reconstitution

For competitive reconstitution experiments 7.5 × 105 BM cells from wild-type adult (12-week-old) B6 SJL-Ptprca Pepcb/BoyCrl (Ly5.1/CD45.1) donors were co-transplanted with 2.25 × 106 BM cells (ratio 1:3, wt:tg) from C57Bl/6 (Ly5.2/CD45.2) SMARCA5 transgenic donors and their respective controls into lethally irradiated (8.5 Gy) adult (12-week-old) Ly5.1 mice. In addition, hematopoiesis was assessed in SMARCA5 transgenic hosts by transplanting 3 × 106 BM cells collected from wild-type 12-week-old Ly5.1 mice into non-irradiated or irradiated (2, 3, 4, 5, up to 6 Gy) Ly5.2 SMARCA5 transgenic hosts and controls. Hematopoietic repopulation was analyzed using flow cytometry analysis of peripheral blood collected at monthly intervals (1 to 4 months) after transplantation.

RT-PCR

RNA from homogenized organs was purified with TRIzol™ (cat. no. 15596026, Thermo Fisher, Waltham, MA, USA), treated with DNA-free™ DNA Removal Kit (cat. no. AM1906, Thermo Fisher, Waltham, MA, USA) and reverse transcribed with High-Capacity cDNA Reverse Transcription Kit (cat. no. 4374966, Thermo Fisher, Waltham, MA, USA). qPCR amplification using LightCycler® 480 SYBR Green I Master (cat. no. 04887352001, Roche, Basel, CH). Primers: mS5 F: AGAATTTGCTTTCAGTTGGAGATTACCG, mS5 R: AGATGAGCCAATTCAATCCTCGC, hS5 F: AGAACTTACTATCCGTTGGCGATTACC; hS5 R: AAGAAATGAGCCAGTTTAATCCTCGG, mGapdh F: ACTTTGTCAAGCTCATTTCCTGGTATG-3´, mGapdh R: TTTCTTACTCCTTGGAGGCCATGTAG, mHprt F: GCTGGTGAAAAGGACCTCT, mHprt R: CACAGGACTAGAACACCTGC.

Protein immunoprecipitation

Organs from 7–9-week-old mice (S5del/wt S5tg/tg and controls) were rapidly frozen using liquid nitrogen, homogenized and lysed in an isotonic lysis buffer (150 mM NaCl, 50 mM Tris-HCl pH=7.5, 0.4% Triton X-100, 2 mM CaCl2, 2 mM MgCl2, 1 mM EDTA, 5 mM NaF in ddH2O) with Benzonase nuclease (250 U/ml, cat.no. SC-391121B, Santa Cruz Biotechnology, Texas, USA), protease and phosphatase inhibitors and 10 mM Na3VO4 for 20 min on ice. After sonication, tissue lysates were further cleared by ultracentrifugation (20,000 g, 4 °C, 10 min) and filtration using a 0.45 μm filter. Individual tissue protein concentrations were equilibrated and lysates corresponding to 100-250 mg of tissue were incubated with 50 μl of anti-FLAG M2 Affinity Gel (cat. no. A2220, Sigma-Aldrich, St. Luis, MO, USA) for three hours. The immunoprecipitated complexes were washed four times with a lysis buffer and eluted with 3xFLAG peptide (cat. no. F4799, Sigma-Aldrich, St. Luis, MO, USA) in a detergent-free lysis buffer. The eluates were then analyzed by mass spectrometry.

Mass spectrometry details

Eluates were acetone precipitated and resuspended in 100 mM TEAB containing 1% SDC. Cysteines were reduced with 5 mM final concentration of TCEP (60°C for 60 min) and blocked with 10 mM final concentration of MMTS (10 min, RT). Samples were cleaved on beads with 1 µg of trypsin at 37 °C overnight. After digestion samples were centrifuged and supernatants were collected and acidified with TFA to 1% final concentration. SDC was removed by extraction to ethyl acetate26. Peptides were desalted using in-house made stage tips packed with C18 disks (Empore) according to27.

Nano Reversed phase column (EASY-Spray column, 50 cm × 75 µm ID, PepMap C18, 2 µm particles, 100 Å pore size) was used for LC/MS analysis. Mobile phase buffer A was composed of water and 0.1% formic acid. Mobile phase B was composed of acetonitrile and 0.1% formic acid. Samples were loaded onto the trap column (Acclaim PepMap300, C18, 5 µm, 300 Å Wide Pore, 300 µm × 5 mm, 5 Cartridges) for 4 min at 15 μl/min. Loading buffer was composed of water, 2% acetonitrile and 0.1% trifluoroacetic acid. Peptides were eluted with Mobile phase B gradient from 4% to 35% B in 60 min. Eluting peptide cations were converted to gas-phase ions by electrospray ionization and analyzed on a Thermo Orbitrap Fusion (Q-OT-qIT, Thermo). Survey scans of peptide precursors from 400 to 1600 m/z were performed at 120 K resolution (at 200 m/z) with a 5 × 105 ion count target. Tandem MS was performed by isolation at 1,5 Th with the quadrupole, HCD fragmentation with normalized collision energy of 30, and rapid scan MS analysis in the ion trap. The MS2 ion count target was set to 104 and the max injection time was 35 ms. Only those precursors with charge state 2–6 were sampled for MS2. The dynamic exclusion duration was set to 45 s with a 10 ppm tolerance around the selected precursor and its isotopes. Monoisotopic precursor selection was turned on. The instrument was run in top speed mode with 2 s cycles28.

All data were analyzed and quantified with the MaxQuant software (version 1.5.3.8)29. The false discovery rate (FDR) was set to 1% for both proteins and peptides and we specified a minimum length of seven amino acids. The Andromeda search engine was used for the MS/MS spectra search against the Caenorhabditis elegans database (downloaded from Uniprot in April 2015, containing 25 527 entries). Enzyme specificity was set as C-terminal to Arg and Lys, also allowing cleavage at proline bonds and a maximum of two missed cleavages. Dithiomethylation of cysteine was selected as fixed modification and N-terminal protein acetylation, methionine oxidation and serine/threonine/tyrosine phosphorylation as variable modifications. The “match between runs” feature of MaxQuant was used to transfer identifications to other LC-MS/MS runs based on their masses and retention time (maximum deviation 0.7 min) and this was also used in quantification experiments. Quantifications were performed with the label-free algorithms described recently. Data analysis was performed using Perseus 1.5.2.4 software.

Targeted parallel reaction monitoring of SMARCA5 peptides

Sorted cells from LSK (Linc-Kit+Sca+) and LSK (Linc-Kit+Sca1) cell populations were washed with PBS and cell pellet was lysed with 0.1% RapiGest (Waters) in 50 mM ammonium bicarbonate (Sigma Aldrich). Protein cysteines were reduced with 5 mM dithiothreitol (Thermo Scientific) for 30 min at 56 °C and alkylated with 10 mM iodoacetamide (Sigma Aldrich) for 30 min at room temperature in the dark. Proteins were digested with sequencing grade modified trypsin (Promega) (enzyme:protein ratio 1:50) at 37 °C over night. The reaction was stopped by adding trifluoroacetic acid to a final concentration of 1% (v/v), and RapiGest was precipitated by further incubation at 37 °C for 45 min. Supernatant was cleaned up using solid phase extraction stage tips and dried by vacuum centrifugation. Peptide digests were spiked in with equivalent amount of heavy peptides premix normalized to the used cell count (Supplementary Table 2).

Five peptides used for targeted parallel reaction monitoring (PRM) using mass spectrometry were selected according to reliable detection in shotgun analysis fulfilling these criteria (1) unique; (2) no missed cleavages (3) not containing cysteine; (4) no modifications and using Picky30 (Table 2). Heavy peptides were purchased from JPT Peptide (JPT Technologies, Berlin, Germany). Cell lysates with spiked in heavy standards were first separated using Ultimate 3000 liquid chromatography system (Dionex). Nano reversed phase columns (Aurora Ultimate TS, 25 cm × 75 μm ID, 1.7 μm particle size, Ion Opticks) were used for LC/MS analysis. Mobile phase buffer A was composed of water and 0.1% formic acid. Mobile phase B was composed of acetonitrile and 0.1% formic acid. Samples were loaded onto the trap column (C18 PepMap100, 5 μm particle size, 300 μm × 5 mm, Thermo Scientific) for 4 min at 18 μl/min loading buffer was composed of water, 2% acetonitrile and 0.1% trifluoroacetic acid. Peptides were eluted with Mobile phase B gradient from 4% to 35% B in 16 min. Total analysis time was 30 min per sample. Samples were analyzed by PRM on Orbitrap Ascend (Thermo Scientific). Eluting peptide cations were converted to gas-phase ions by electrospray ionization in positive mode with 1600 V spray voltage. MS data were acquired using tMS2 mode. RF lens amplitude was set to 60%. Peptide precursors were isolated by quadrupole with 1.6 m/z isolation window and fragmented by HCD with collision energy set to 28%. Fragment ions were detected in orbitrap with 30 K resolution at 200 m/z. AGC was set to 250% and maximum injection time mode to Auto. Total cycle time was set to 0.8 s. All peptides with their corresponding masses and charge states are listed in the Table 2. Data were analyzed using Skyline-daily (64-bit) version 23.1.1.268. Identical heavy and light transitions and retention times confirmed peptide identity. A minimum of four transitions was required for reliable detection. All peaks were manually inspected to confirm correct detection and peak boundaries. Peak integration and calculation of the ratios between light endogenous and the heavy-labeled peptide (L/H) were done in Skyline and result reports exported from the software.

Table 2 List of peptides used for PRM detection of protein SMARCA5

Sequence coverage by selected peptides

>sp|O60264 | SMCA5_HUMAN SWI/SNF-related matrix-associated actin-dependent regulator of chromatin subfamily A member 5 OS=Homo sapiens OX = 9606 GN = SMARCA5 PE = 1 SV = 1.

MSSAAEPPPPPPPESAPSKPAASIASGGSNSSNKGGPEGVAAQAVASAASAGPADAEMEEIFDDASPGKQKEIQEPDPTYEEKMQTDRANRFEYLLKQTELFAHFIQPAAQKTPTSPLKMKPGRPRIKKDEKQNLLSVGDYRHRRTEQEEDEELLTESSKATNVCTRFEDSPSYVKWGKLRDYQVRGLNWLISLYENGINGILADEMGLGKTLQTISLLGYMKHYRNIPGPHMVLVPKSTLHNWMSEFKRWVPTLRSVCLIGDKEQRAAFVRDVLLPGEWDVCVTSYEMLIKEKSVFKKFNWRYLVIDEAHRIKNEKSKLSEIVREFKTTNRLLLTGTPLQNNLHELWSLLNFLLPDVFNSADDFDSWFDTNNCLGDQKLVERLHMVLRPFLLRRIKADVEKSLPPKKEVKIYVGLSKMQREWYTRILMKDIDILNSAGKMDKMRLLNILMQLRKCCNHPYLFDGAEPGPPYTTDMHLVTNSGKMVVLDKLLPKLKEQGSRVLIFSQMTRVLDILEDYCMWRNYEYCRLDGQTPHDERQDSINAYNEPNSTKFVFMLSTRAGGLGINLATADVVILYDSDWNPQVDLQAMDRAHRIGQTKTVRVFRFITDNTVEERIVERAEMKLRLDSIVIQQGRLVDQNLNKIGKDEMLQMIRHGATHVFASKESEITDEDIDGILERGAKKTAEMNEKLSKMGESSLRNFTMDTESSVYNFEGEDYREKQKIAFTEWIEPPKRERKANYAVDAYFREALRVSEPKAPKAPRPPKQPNVQDFQFFPPRLFELLEKEILFYRKTIGYKVPRNPELPNAAQAQKEEQLKIDEAESLNDEELEEKEKLLTQGFTNWNKRDFNQFIKANEKWGRDDIENIAREVEGKTPEEVIEYSAVFWERCNELQDIEKIMAQIERGEARIQRRISIKKALDTKIGRYKAPFHQLRISYGTNKGKNYTEEEDRFLICMLHKLGFDKENVYDELRQCIRNSPQFRFDWFLKSRTAMELQRRCNTLITLIERENMELEEKEKAEKKKRGPKPSTQKRKMDGAPDGRGRKKKLKL

Statistics and reproducibility

All our experiments are reproducible, statistical methods are indicated in figure legends as well as sample sizes.

Reporting summary

Further information on research design is available in the Nature Portfolio Reporting Summary linked to this article.