DEAD-box RNA helicase 10 is required for 18S rRNA maturation by controlling the release of U3 snoRNA from pre-rRNA in embryonic stem cells

Cell culture

mESCs were cultured on gelatin-coated plates in DMEM high-glucose media (Hyclone, SH30022.01) supplemented with 15% FBS (GIBCO, 10082147), 1 mM sodium pyruvate (GIBCO, 11360070), 1 × non-essential amino acids (GIBCO, 11140-050), 1 × GlutaMAX (GIBCO, 35050061), 0.1 mM 2-mercaptoethanol (GIBCO, 21985023), 1000 U/mL leukemia inhibitory factor (LIF) (Millipore, ESG1107), and the 2i inhibitors (3 μM CHIR99021 (Selleck, S2924) and 1 μM PD0325901 (Selleck, S1036)). NIH3T3 and HEK293T cells were maintained in DMEM high-glucose media containing 10% FBS (Natocor, SFBE). Degradation of DDX10 was induced by treating mESCs with a final concentration of 500 µM IAA (Solarbio, I8780). For the IAA wash off experiments, mESCs were initially treated with IAA for 2 days. Subsequently, the medium was replaced with culture medium without IAA, and the cells were cultured for an additional 2 days, with daily medium changes.

Plasmid constructions and lentivirus production

For the overexpression of FLAG-tagged DDX10 in mESCs, the Ddx10 fused with a Flag-tag was inserted into PiggyBac plasmid. To construct the Ddx10 donor plasmid, the AID-eGFP tag was PCR amplified from CTCF-AID-eGFP targeting vector (Addgene, 86230)⁵¹. Two homology arms (~1 kb each) around the stop codon of the Ddx10 gene were amplified by PCR from E14 genomic DNA. The homology arms and AID-eGFP tag were cloned into pEASY-Blunt plasmid (TransGen, CB101). The OsTir1 was PCR amplified from pEN114 (Addgene, 92143)⁵¹, and then cloned into pSIN-Flag lentiviral vector with a puromycin resistance gene. Ddx10-targeting sgRNAs were cloned into pX330 plasmid by annealing oligos CACCGGCCTGTAAAACAAACAAGCA and AAACTGCTTGTTTGTTTTACAGGCC. The full-length and different truncated sequences of Ddx10 were generated by PCR using mouse cDNA as the template. These truncated sequences and mCherry were cloned into pSIN-Flag lentiviral vector with a puromycin resistance gene, and HA-tagged Ddx10_FL and different truncation were cloned into pSIN-Flag lentiviral vector with a BSD resistance gene. HA-tagged NUP98-DDX10 and DDX10 were generated by PCR using human cDNA as the template, then these sequences were cloned into pSIN-Flag lentiviral vector with a BSD resistance gene. Lentivirus supernatants were generated with HEK293T cells. HEK293T cells were plated and cultured overnight. The medium of a 10 cm dish was replaced with 9 mL fresh culture medium, and then co-transfected with pSIN vector containing target genes together with the packaging plasmids pMD2.G and psPAX2 using polyethyleneimine (PEI; Polysciences, 24765–2). The culture medium was refreshed 12 h after transfection. After that, the supernatant from the transfected HEK293T cells was collected 48 h post-transfection using a syringe and filtered through a 0.45 μm filter.

Generation of cell lines

To generate DDX10-AID mESCs, Ddx10 donor plasmid and sgRNA were transfected into E14 cells (ATCC, CRL-1821) using FuGENE® 6 Transfection Reagent (Promega, E2691). Single colonies were picked up and identified by PCR genotyping. Subsequently, the cells were either infected with OsTir1 lentivirus or co-transfected with pEN396 donor plasmid (Addgene, 92142) and pX330-EN1201 plasmid (Addgene, 92144) which expresses an sgRNA targeting the Tigre locus. The cells were then selected with 2 µg/mL puromycin (GIBCO, A11138-03) for 3 days. To generate overexpressing FLAG-tagged DDX10 mESCs, E14 cells were co-transfected with the PB-Ddx10-Flag-Puro vector and pBase vector, and selected with 2 µg/mL puromycin for 3 days. For phase separation experiments, NIH3T3 cells were infected with lentiviruses carrying mCherry-tagged DDX10_FL, DDX10_ΔIDR1, DDX10_ΔIDR2, DDX10_ΔIDR3 and DDX10_ΔIDR3-NLS, respectively, and selected with 2 µg/mL puromycin for 3 days. To generate DDX10-AID mESCs overexpressing HA-tagged DDX10_FL, DDX10_ΔHBD, DDX10_ΔHCD, DDX10_ΔHD, DDX10_ΔIDR1, DDX10_ΔIDR2, DDX10_ΔIDR3, DDX10_ΔIDR3-NLS, NUP98-DDX10 and DDX10, cells were infected with lentiviruses and selected with 10 µg/mL blasticidin (Yeasen, 60218ES10) for 5 days. For all mESC lines, single cell clones were picked up and identified by immunoblotting.

Western blot

Protein samples were obtained with cell lysis buffer (50 mM Tris-HCl (pH7.6), 1% Triton X-100, 1 mM EDTA, 10% glycerol and 1 × protease inhibitor cocktail). The lysates were centrifuged at 12,000 × g at 4 °C for 10 min, and soluble protein was quantified. Equal amounts of total protein were separated in SDS-PAGE gel and transferred onto polyvinylidene fluoride (PVDF) membrane. The PVDF membrane was subsequently incubated with the diluted primary antibody and secondary antibodies. Antibodies are listed in Supplementary Data 3.

Quantitative RT-qPCR analysis

Total RNAs were extracted with Trizol Reagent (MRC, TR118) according to the manufacturer’s instructions. 1 µg of total RNA was reverse transcribed into cDNA using the HiScript® III RT SuperMix for qPCR (Vazyme, R323-01) or the HiScript II 1^st Strand cDNA Synthesis Kit (Vazyme, R212-01) with random primers, and then analyzed by qPCR with SYBR green mixture (Genstar, A301-01) and performed on a CFX Real-Time System (Bio-Rad). The primers used for qPCR analysis are listed in Supplementary Data 4.

Immunofluorescence

Cells were seeded on glass coverslips or glass-bottom cell culture dishes. Cultured cells were fixed with 4% paraformaldehyde for 15 min at room temperature (RT). Subsequently, cells were permeabilized with 0.5% Triton X-100 in PBS for 30 min. Cells were blocked with 1% BSA (bovine serum albumin) in PBS for 1 h at RT. Primary antibodies were applied and incubated overnight at 4 °C, and then cells were incubated with the appropriate secondary antibodies in the dark for 1 h at RT. Antibodies are detailed in Supplementary Data 3. Nuclei were counterstained with DAPI (Sigma-Aldrich, D9542) or Hoechst 33342 (Sigma-Aldrich, 14533). The slides were examined using Zeiss inverted 880/900 confocal microscope, Zeiss Elyra 7 with Lattice SIM or Leica SP8 STED super-resolution microscope. Images were further processed with ZEN blue software.

Cell proliferation assay

Cell proliferation assays were performed using Cell Counting Kit-8 (CCK-8) (Selleck, B34304). Briefly, 1,500 cells were seeded in 96-well plate with 100 µL of complete medium per well. The following day, cells were treated with or without IAA. 10 µL of CCK-8 reagent was added to each well and incubated for 3 h at 37 °C. Subsequently, the absorbance at 450 nm was measured using a microplate spectrophotometer at the indicated time points after IAA treatment.

Fluorescence-activated cell sorting (FACS)

Cell cycle was conducted using Cell Cycle Detection Kit (KeyGen, KGA512). Cells were treated with IAA at different time points, harvested and fixed with 70% cold ethanol at 4 °C overnight. Subsequently, cells were incubated with propidium iodide (PI)/RNase A for 30-60 min. Cell apoptosis analysis was conducted with APC-Annexin V/PI Apoptosis Detection Kit (Bioscience, A6030L). Cells were suspended with binding buffer and incubated with Annexin V-APC and PI solution in the dark at RT for 5–15 min. FACS analysis was performed using LSR Fortessa SORP flow cytometer (BD Biosciences). FlowJo software was used for further analysis of the obtained data.

RNA-seq and bioinformatics analysis

RNAs were extracted from DDX10-AID mESCs treated with IAA at different time points. RNA libraries were generated with VAHTS Universal V6 RNA-seq Library Prep Kit for Illumina (Vazyme, NR604-01/02). Adapter sequences were removed using Trim Galore (v0.6.5) and reads < 20 nucleotides were discarded. Reads were then mapped to mouse (mm10) genome with STAR-RSEM pipeline using ENSEMBL version 79 gene annotation as reference. Differential gene expression was determined using DESeq2 (v1.32.0)⁸², the p-value adjusted for multiple comparisons. Genes with log2 (fold change) > 1.5 and q-value < 0.05 were considered significantly different. Gene ontology and gene set enrichment analysis (GSEA) was performed using the clusterProfiler (v4.0.0)⁸³. Clustering of gene expression pattern was determined with Mfuzz (v2.52.0)⁸⁴. RNA-seq data of mouse naive, primed ESCs (GSE226316) and preimplantation embryos (GSE66582) were analyzed using the same procedure outlined above. For analyzing 2 cell-specific genes, the significantly upregulated genes between the two-cell stage and every other stage were firstly identified, and then intersected to yield the co-upregulated genes among all comparisons. These co-upregulated genes were determined as 2 cell-specific genes.

CLIP-seq

FLAG-tagged DDX10 mESCs grown on 10 cm plate were collected and crosslinked with 400 mJ/cm² of 254 nm UV light. Nuclei were prepared by incubating the cells in buffer A (10 mM Tris-HCl (pH7.4), 10 mM KCl, 1.5 mM MgCl₂, 1 mM PMSF, 1 mM DTT, 1 × proteinase inhibitor cocktail and 40 U/mL RNase inhibitor) on ice for 15 min. Then the cells were ground with a loose pestle and centrifuged at 2000 × g at 4°C for 10 min. After centrifugation, the soluble cytoplasm was discarded and the insoluble cell nuclei were resuspended in low salt buffer (2.5 times volume of cell pellet, 20 mM Tris-HCl (pH7.4), 20 mM KCl, 25% glycerol, 1.5 mM MgCl₂, 0.2 mM EDTA, 1 mM PMSF, 1 mM DTT, 1 × proteinase inhibitor cocktail and 40 U/mL RNase Inhibitor). And then high salt buffer (0.5 times volume of low salt buffer, 20 mM Tris-HCl (pH7.4), 1.2 M KCl, 25% glycerol, 1.5 mM MgCl₂, 0.2 mM EDTA, 1 mM PMSF, 1 mM DTT, 1 × proteinase inhibitor cocktail and 40 U/mL RNase Inhibitor) was added to the nuclear lysate. The lysate was incubated on a rotator at 4 °C for 30 min, and then treated with 30 μL RQ1 DNase (Promega, M6101) at 37 °C for 3 min. The insoluble pellet was centrifuged, and the supernatant was harvested. And then the following buffer (20 mM Tris-HCl (pH7.4), 0.1% SDS and 5 mM EDTA) was added to adjust the salt concentration to 150 mM KCl. About 50 μL of FLAG-M2 magnetic beads (Sigma-Aldrich, M8823) were used for each immunoprecipitation. The beads were incubated with lysate at 4 °C overnight. The beads were washed twice with cold wash buffer (1 × PBS (tissue culture grade; without Mg²⁺ and Ca²⁺), 0.1% SDS, 0.5% sodium deoxycholate and 0.5% NP-40), followed by two times with high salt wash buffer (5 × PBS, 0.1% SDS, 0.5% NP-40 and 0.5% sodium deoxycholate) and two more times with PNK buffer (50 mM Tris-HCl (pH 7.4), 10 mM MgCl₂ and 0.5% NP-40). Then the protein-RNAs complexes were partially digested with Micrococcal Nuclease (MNase, 1:1 × 10³/1:5 × 10⁵ dilution) (NEB, M0247S) at 37 °C for 10 min. The reaction was stopped by PNK-EGTA buffer (PNK buffer with 2 mM EGTA). The beads were washed once with high salt buffer, once with wash buffer and twice with PNK buffer. The beads were treated with FastAP thermosensitive alkaline phosphatase (Thermo Fisher Scientific, EF0652) at 37 °C for 20 min. After two washes with PNK-EGTA buffer and twice with PNK buffer, the pre-adenylated 3’ linker (rAppTGGAATTCTCGGGTGCCAAGG-NH2 (biotin)) was ligated with T4 RNA Ligase 2, truncated KQ (NEB, M0373S) overnight at 16 °C. The non-ligated 3’ linker was washed away with PNK buffer. The RNAs were then phosphorylated using T4 PNK (NEB, M0201S) at 37 °C for 30 min. And then the protein-RNA complexes were subjected to 4%-12% NuPAGE Bis-Tris protein gel (Invitrogen, NP0321BOX) separation and transferred to nitrocellulose membrane. The biotin-labeled RNA-protein complexes were identified by chemiluminescent nucleic acid detection module kit (Thermo Fisher Scientific, 89880). The RNAs were purified though proteinase K treatment and overnight precipitation. The purified RNAs were ligated with 5’ RNA adapter (5’-ACACGrArCrGrCrUrCrUrUrCrCrArUrCrUrNrNrNrU-3’) using T4 RNA Ligase 1 (NEB, M0204S). RNAs were reverse transcribed using Superscript III reverse transcriptase (Thermo Fisher Scientific, 18080044) with RT primer (5’-CCTTGGCACCCGAGAATTCCA-3’) and amplified for 15-18 cycles using Phusion High-Fidelity DNA Polymerase (NEB, M0530S) (DP5: 5’-ACACGACGCTCTTCCGATCT-3’; DP7: 5’-CCTTGGCACCCGAGAATTCCA-3’). Library index sequences were introduced by PCR using index primers (P5: 5’-AATGATACGGCGACCACCGAGATCTACACAACCCACACTCTTTCCCTACACGACGCTCTTCCGATCT-3’, P7: 5’-CAAGCAGAAGACGGCATACGAGATCGTGATGTGACTGGAGTTCCTTGGCACCCGAGAATTCCA-3’) for 8-10 cycles. CLIP-seq libraries were generated and followed by high-throughput sequencing with Illumina Novaseq 6000 sequencing platform.

Analysis of CLIP-seq data

Single end reads with UMI sequences (NNNT) were selected. Fastx_clipper tool from fastx toolkit (v0.0.14) was used to remove 3’ linker sequence with parameters “-a TGGAATTCTCGGGTGCCAAGG -l 20 -n”. Fastq2collapse.pl from CLIP Tool Kit (CTK) (v1.1.3)⁸⁵ was used to remove PCR duplicates, then subjected to stripBarcode.pl to remove 5’UMI sequences with parameters “-format fastq -len 4”.

Reads were mapped to mouse (mm10) genome with bwa software (v0.7.17)⁸⁶. Sam files were parsed with parseAlignment.pl, tag2collapse.pl, joinWrapper.py tools from the CLIP Tool Kit (CTK)⁸⁵, and then handled with tag2peak.pl to get enriched peaks, which was annotated with ChIPseeker (v1.28.3)⁸⁷. BamCoverage from deeptools (v3.5.1)⁸⁸ was used to generate normalized bigwig files with parameters “–normalizeUsing RPGC –effectiveGenomeSize 2494787188”. Reads were also mapped to pre-45S DNA sequence (downloaded from NCBI: X82564) with bwa software. BamCoverage was used to generate normalized bigwig files with parameters “–normalizeUsing RPGC –effectiveGenomeSize 22118”.

hnRNP CLIP data (GSE77101-GSM2044162)⁸⁹ was handled as above.

Northern blot

Northern blot experiments were performed as described⁹⁰. Total RNAs were extracted from mESCs treated with IAA at different times using Trizol Reagent (MRC). Biotin-labeled probes targeting 5’ETS-1, 5’ETS-2, ITS1-29, 5’ETS, U3 and U14 were synthesized by IGE biotechnology (Guangzhou). The specific sequences of the probes used are listed in Supplementary Data 4. For analysis of high-molecular-weight RNAs, 3 µg of total RNAs were resolved on agarose denaturing gels (1.3% formaldehyde/1% agarose in HEPES-triethanolamine (HT) buffer). For the analysis of the low-molecular-weight RNAs, 1.5 µg of RNAs were separated on denaturing acrylamide gels. After electrophoresis, the RNAs were transferred onto nylon membranes (GE Amersham, RPN303B). Membranes were stained with methylene blue stain solution (0.03% methylene blue (MedChemExpress, HY-14536) in 0.3 M sodium acetate (pH 5.0-5.5)), and then RNA was crosslinked onto the membrane using UV light. The membranes were prehybridized at 50 °C for 1 h in hybridization solution (5 × SSC, 5 × Denhardt’s solution and 0.5% SDS). The biotin-labeled oligonucleotide probe (20-40 pmol) was added to the hybridization solution, and the membranes were incubated at 50 °C overnight. Detection of the biotin-labeled oligonucleotide probes was performed using Chemiluminescent Nucleic Acid Detection Module Kit (Thermo Fisher Scientific, 89880) according to the manufacturer’s instructions.

Sucrose gradient fractionation of polysome

2 × 10⁷ cells were treated with CHX (100 µg/mL) (Selleck, S7418) at 37 °C for 10 min. After treatment, the cells were lysed with lysis buffer (25 mM Tris-HCl (pH7.4), 5 mM MgCl₂, 100 mM NaCl, 1% NP-40, 1% sodium deoxycholate, 40 U/mL RNase Inhibitor, 1 × protease inhibitor cocktail, 100 µg/mL CHX and 1 mM DTT) on ice for 30 min. The cell lysates were centrifuged at 13,000 × g at 4 °C for 10 min and the supernatant was loaded onto 10% – 50% sucrose gradients. The gradients were then subjected to ultracentrifugation using a SW41 rotor at 222,228 × g at 4 °C for 3 h. The absorbance at 260 nm was recorded using a BioComp Piston Gradient Fractionator equipped with a Bio-Rad Econo UV Monitor.

Transmission electron microscopy (TEM)

The cells were cultured on glass coverslips in 24-well plates and fixed with 2.5% glutaraldehyde for 30 min at RT. Next, the cells were fixed with 1% osmium acid for 30 min and then dehydrated in a graded series of ethanol solutions (50%, 70%, 80%, 90%, 100% and 100%) for 2 min each. After dehydration, the cells were covered with resin and infiltrated at RT for 2 h. The samples were then embedded and polymerized at 40°C for 2-4 h, followed by an additional 12 h at 60 °C. After ultra-sectioning, the sections were double-stained with uranyl acetate and lead citrate. Samples were examined with a transmission electron microscope (FEI Tecnai G2 Spirit).

Quantification of nascent protein synthesis

Nascent protein synthesis in mESCs was detected using a Click-iT HPG Alexa Fluor 594 Protein Synthesis Assay Kit (Thermofisher, C10429), following the manufacturer’s instruction. Briefly, on the day of the experiment, the regular mESC culture medium was replaced by L-methionine-free DMEM medium containing 50 µM Click-iT HPG and incubated for 30 min. After incubation, the cells were washed once with 1 × PBS and fixed with 4% paraformaldehyde at RT for 15 min. Subsequently, the cells were washed twice with 3% BSA and permeabilized with 0.5% Triton X-100 in PBS for 20 min. The Click-iT reaction cocktail was added to each well and incubated at RT for 30 min. Then, the DNA was stained by HCS NuclearMask Blue Stain reagent for 30 min. Finally, the images were captured using Zeiss inverted 900 confocal microscope. For quantification, relative HPG incorporation was presented as the intensity of HPG: NuclearMask blue ratio.

Co-Immunoprecipitation (Co-IP)

Nuclear protein extracts were prepared from FLAG-tagged DDX10 mESCs. 1 mg of proteins was used for each co-IP experiment. The protein samples were incubated overnight with 2 µg of antibodies (DDX10 antibody and normal rabbit IgG). Following the incubation, 15 µL of protein A (Invitrogen, 10001D) and 15 µL of protein G (Invitrogen, 10004D) dynabeads were added to the samples and incubated at 4 °C for 4 h. After incubation, the beads were washed three times with IP wash buffer (50 mM Tris-HCl (pH7.6), 150 mM KCl, 0.1% Triton X-100, 1 mM EDTA and 1 × protease inhibitor cocktail). The bound proteins were then eluted from the beads, loaded onto SDS-PAGE gel and transferred to PVDF membrane (Merck, IPVH00010). Then the membrane was incubated with the indicated antibodies. Antibodies are detailed in Supplementary Data 3.

RNA immunoprecipitation followed by qPCR or Northern blot

2 × 10⁷ FLAG-tagged DDX10 mESCs were lysed with lysis buffer (10 mM HEPES (pH7.0), 100 mM KCl, 5 mM MgCl₂, 0.5% NP-40, 1 mM DTT, 100 U/mL RNase inhibitor and 1 × proteinase inhibitor cocktail). 2-5 µg of antibodies (DDX10 antibody and normal rabbit IgG) were added to cell lysate and incubated overnight at 4 °C. Then, protein A/G dynabeads (Invitrogen) were added to the protein-antibody complexes and incubated at 4 °C for 4 h. The beads-protein-RNA complexes were washed 5 times with RIP wash buffer (50 mM Tris-HCl (pH7.4), 1 mM MgCl₂, 150 mM NaCl and 0.05% NP-40) and incubated with DNase I digestion at 37 °C for 30 min, then digested with proteinase K at 37 °C for 30 min with shaking. Finally, RNAs were extracted with Trizol Reagent and purified for qPCR or Northern blot analysis.

Preribosomes isolation

The cells were cultured in 150 mm plates, and lysed with NP-40 lysis buffer (10 mM Tris-HCl (pH 7.5), 150 mM NaCl, 0.05% NP-40, 40 U/mL RNase Inhibitor, 1 × protease inhibitor cocktail) on ice for 5 min. The lysis was loaded onto the NP-40 lysis buffer containing 24% sucrose and centrifuged at 6,000 × g at 4 °C for 10 min. Then the supernatant was discarded and the nuclear precipitation was washed once with cold PBS. Nuclei were sonicated in the buffer containing 20 mM Tris-HCl (pH 7.5), 100 mM NaCl, 1 mM NaF, 2 mM EDTA, 0.05% Igepal CA-630, 1 mM DTT, 1 × protease inhibitor cocktail, and 50 U/mL RNase inhibitor and then fractionated on a 10% – 30% sucrose gradient. Following fractionation, RNAs in each fraction were extracted and analyzed by Northern blot.

Fluorescence recovery after photobleaching (FRAP)

NIH3T3 cells (overexpressing mCherry-tagged DDX10_FL, DDX10_ΔIDR1, DDX10_ΔIDR2 and DDX10_ΔIDR3-NLS, respectively) were cultured on glass-bottom cell culture dishes and seeded 12 to 24 h prior to the experiment. Cells were stained with Hoechst 33342 for 10 min at room temperature before experiments. FRAP experiments was performed using Zeiss inverted 900 confocal microscope equipped with a 63 ×  objective. All experimental parameters were kept constant in the independent experiments and conditions. For quantitative analysis, the average fluorescence intensity of frames captured before photobleaching was normalized to 100%. Data were analyzed using GraphPad Prism 8.

Protein purification

Ddx10_FL, Ddx10_ΔIDR1, Ddx10_ΔIDR2 and Ddx10_ΔIDR3 sequences were generated by PCR from mouse cDNA. These sequences and mCherry were cloned into a pET-28a expression plasmid. The plasmids were first transformed into BL21 (DE3) E. coli cells (TransGen). The transformed cells were grown at 37°C in LB media containing kanamycin, and then diluted 1:100 in 500 ml LB media supplemented with kanamycin. After ~4 h, the cells were grown to OD600 of ~0.6-0.8. To induce protein expression, IPTG was added to the bacterial culture at a final concentration of 0.5 µM. The cells were then induced overnight in 20°C. The cells were harvested by centrifugation at 3,000 × g at 4°C for 10 min. Cell pellet was resuspended in the buffer containing 0.5 M NaCl, 50 mM Tris-HCl (pH 7.5), 0.2% Triton X-100, 20 mM imidazole, 10% glycerol and EDTA-free protease inhibitor cocktail. The resuspended cells were lysed using Low-temperature ultra-high pressure continuous flow cell disrupter (JN-Mini Pro). The proteins were purified with Ni-NTA agarose beads and eluted from the beads using the buffer containing 0.5 M NaCl, 50 mM Tris-HCl (pH 7.5), 0.2% Triton X-100, 300 mM imidazole, 10% glycerol, 1 mM DTT and EDTA-free protease inhibitor cocktail. The eluted protein was concentrated using Amicon Ultra Centrifugal filters (Millipore). The concentration of purified proteins was determined using the Pierce BCA Protein Assay Kit (Thermo Fisher Scientific, 23227) and stored in aliquots at -80°C.

Droplet formation

mCherry-fused DDX10 full-length and truncated proteins were thawed on ice and then centrifuged at 13,000 × g at 4°C for 10 min. The indicated protein at a final concentration of 0.5 µM was added to droplet formation buffer (5% (w/v) PEG8000, 50 mM Tris-HCl (pH 7.5), 150 mM NaCl, 10% glycerol and 1 mM DTT). The reaction mixture was incubated at RT for 1 min to allow for droplet formation, and then loaded into a custom slide chamber made from glass coverslips mounted on two parallel strips of double-sided tape on slides. Reactions were incubated for 5 min in the imaging vessel to allow droplets in solution to settle on the glass imaging surface. Phase-separated droplets were imaged by Zeiss inverted 900 confocal microscope.

Statistics and reproducibility

Data were presented as mean ± SD unless otherwise indicated in the figure legend. The number of statistical sample and experimental repeats were indicated in the figures and legends. Experimental data were plotted and analyzed using either Excel or GraphPad Prism 8, and statistical significance was determined by Student’s t-test analysis (two-tailed) for two groups, unless otherwise indicated. The exact p-values are indicated in the figures. The uncropped and unprocessed scans of all blots and gels were provided in the Source Data file and the Supplementary Information.

Reporting summary

Further information on research design is available in the Nature Portfolio Reporting Summary linked to this article.

• SEO Powered Content & PR Distribution. Get Amplified Today.
• PlatoData.Network Vertical Generative Ai. Empower Yourself. Access Here.
• PlatoAiStream. Web3 Intelligence. Knowledge Amplified. Access Here.
• PlatoESG. Carbon, CleanTech, Energy, Environment, Solar, Waste Management. Access Here.
• PlatoHealth. Biotech and Clinical Trials Intelligence. Access Here.
• Source: https://www.nature.com/articles/s41467-024-53822-0