Broadening alloselectivity of T cell receptors by structure guided engineering

Identification of pHLA by LC-MS/MS

Immortalized cancer cell lines MEL624 (NCI), MEL526 (NCI) and SKMEL28 (ICLC) were cultured according to suppliers’ instructions and lysed in buffer containing non-ionic detergent NP-40 (ThermoFisher) followed by centrifugation to remove cell debris. Flash frozen surgically resected primary tumour specimens were commercially obtained and milled under cryogenic conditions. Small portions of pulverized tissue were collected for HLA typing by NGS (Next Generation Sequencing) (15 to 20 mg). The bulk of the pulverized tumour material was lysed in buffer containing non-ionic detergent NP-40 followed by centrifugation to remove cell debris. HLA class I peptide complexes were enriched by affinity chromatography from lysed cell lines and tissue specimens by passing over resin containing anti-HLA-class I W6/32 antibody immobilized on a protein-A-Agarose scaffold. HLA-peptide complexes were eluted in 0.5% trifluoroacetic acid (TFA)/ 5% acetonitrile (ACN), desalted by reversed phase solid phase extraction (Sep-Pak C18, Waters), reduced in volume by vacuum centrifugation, and stored at -80° C until LC-MS/MS analysis.

HLA peptides were reconstituted in 0.1% TFA/5% ACN, separated by reversed phase liquid chromatography (LC) and analysed by tandem mass spectrometry (MS/MS). Briefly, purified pHLA complexes were loaded onto an Acclaim™ PepMap™ 100 trap column (100 μm x 2 cm, ThermoFisher); separated using an EASY-Spray™ column (75 μm x 50 cm, ThermoFisher) with mobile phase A (0.1% formic acid in water), and B (0.1% formic acid in ACN) at a flowrate of 250 nL/min; eluted into an EASY-Spray™ ionization source (ThermoFisher) and analysed on an Orbitrap Fusion™ Lumos™ Tribrid™ Mass Spectrometer (ThermoFisher). MS/MS data was acquired with data dependent analysis (DDA) with the following settings: full MS1 scan recorded at 120 K resolution (AGC 4E5, 50 ms) after quadrupole isolation (300–1200 m/z range); precursor ions selected for MS2 with a quadrupole isolation window of 1.6 Da (Orbitrap Fusion™) or 1.2 Da (Orbitrap Fusion™ Lumos™), fragmented by HCD with 28% collision energy, and analysed in the Orbitrap at 30 K resolution (AGC 2E4, 240 ms). Stable isotope labelled (SIL) peptides (JPT technologies, Berlin, Germany) were introduced into each sample at an exact molar amount of 100 femtomole immediately prior to MS analysis. MS/MS data was processed with PEAKS7.5 (Bioinformatics Solutions) and searched against the Uniprot human protein database with no enzyme restriction and a tolerance of 5 ppm for MS1 and 0.02 Da for MS2.

TCR isolation and affinity maturation

TCRs specific to A3-ELF were isolated from in-house naïve TCR phage display libraries¹¹. Two TCRs (S2^WT and S8^WT) with confirmed binding to A3-ELF and A11-ELF by surface plasmon resonance were selected for affinity maturation. TCR affinity maturation was performed using phage display methodology^53,54. For S2^WT, a NNK library was designed that allowed all 6 residues of CDR1α to modify. For S8^WT, we adopted the soft library approach such that all 12 residues in CDR3α (AVRQRGSQGNLI) were covered in a single library and had approximately 3% variability at each nucleotide position. TCR phage libraries underwent two rounds of selection using 100 nM A3-ELF immobilised on streptavidin beads. Prior to pan 2 the libraries were counter-selected against 200 nM pHLA A3 streptavidin beads presenting a pool of twenty validated HLA-A*03:01 peptides- KLYEQLSGK, VLYPSAQEK, VLYENPNLK, ALFLTLTTK, SVASPFTSK, ALANVSIEK, SLYKDAMQY, VVYAPLSKK, QLYWSHPRK, LLFANQTEK, QLYSALANK, SLSSPLNPK, ILGPMFSGK, KLLDPIREK, LLYEKNLVK, RLYQHAVEY, QLYKEQLAK, VLYDRVLKY, SLFSNVVTK, GLFGKTVPK.

pHLA expression, purification, and stability measurements

The four mutants HLA-A*03:01 T163R, HLA-A*03:01 F9Y E152A L156Q, HLA-A*11:01 R163T and HLA-A*11:01 Y9F A152E Q156L were made by site directed mutagenesis of HLA-A*03:01 and HLA-A*11:01 using a method described previously⁵⁵.

The wildtype HLA-A*03:01 and HLA*11:01 with and without C-terminal AVI-tag, the four HLA mutants with a C-terminal AVI-tag, and B2m were expressed as inclusion bodies in E. coli. The pHLA complexes were refolded by dilution as described previously⁵⁶ with PRAME peptide (ELFSYLIEK) (Peptide Protein Research Ltd). Following refolding, pHLA complexes were dialysed into 20 mM Tris pH 8.1 and purified by anion exchange chromatography using POROS HQ resin (Applied Biosystems). The purified pHLA complexes with AVI-tags were biotinylated using BirA biotin-protein ligase bulk reaction kit (Avidity) as per manufacturer’s protocol. All pHLAs were further purified by size exclusion chromatography using a Superdex S75 Increase column (Cytiva).

The half-lives of pHLAs were measured at 25 °C by bio-layer interferometry (BLI) using an Octet96. Biotinylated pHLA was loaded onto streptavidin coated pins to a response of 1 nM and the maximal binding response of 5 µM ILT2 c50³¹ was measured every 30 min for four hours. Fresh pins were used for each repeat to generate the triplicate data. The half-lives were calculated using a non-linear fit of the percentage of binding relative to time using GraphPad Prism.

TCR expression, refolding, and purification

Recombinant expression and purification of untagged and AviTag™ S2 and S8 TCRs and their variants were carried out as explained previously^2,57: Sequences are provided in the supplementary material. Briefly, alpha and beta chains of TCRs containing an interchain disulphide bond were cloned into pGMT7 vector and the protein chains were expressed separately using Rosetta DE3 E. coli cells grown in autoinduction media containing ampicillin. Inclusion bodies of TCRα and TCRβ were isolated, mixed (1.5:1 molar ratio) and denatured using buffer containing 50 mM Tris pH 8.1, 100 mM Sodium Chloride, 6 M Guanidine and 20 mM Dithiothreitol (DTT). The mixture was refolded by diluting to a final protein concentration of 60 mg/L into a buffer containing 100 mM Tris pH 8.1, 4 M Urea, 400 mM L-Arginine, 1.9 mM Cystamine and 6.5 mM Cysteamine redox couple. The refolded TCRs were then purified by anion exchange using Poros50 HQ column. Biotinylation of AviTag™ TCRs were carried out as explained before for pHLAs. All samples were further purified by gel filtration using Superdex 75 GL column equilibrated in PBS buffer.

Surface plasmon resonance

Binding analyses were performed using a Biacore T200 equipped with a CM5 sensor chip as reported previously⁵⁸. All experiments were performed at 25 °C and using PBS buffer supplemented with surfactant P20. The biotinylated pHLAs were coupled to the streptavidin coated until the response units reached ~ 1000. Biotin was used to block the remainder of the chip surface. The TCRs were then injected at six concentrations following a series of two-fold dilutions with a top concentration ~ 10x above expected K_D (S2^WT 150 − 4.69 µM- S8^WT 250 − 7.8 µM) at 10 µ/min. The triplicate data, generated using repeat injections over the same surface, were processed using one site total least squares fit in GraphPad Prism 9.0.

Crystallisation and structure solution

S2 and S8 TCRs and were mixed with either A3-ELF or A11-ELF in equimolar ratio and concentrated to 8–10 mg/ml and buffer exchanged to 10 mM Tris pH 8.0, 20 mM NaCl. Sitting drops were set up containing 150 nl of protein solution and 150 nl of reservoir solution in MRC crystallisation plates using the Gryphon robot (ART Robbins) and incubated at 20 °C in Rock Imager 1000 (Formulatrix). Crystals were cryoprotected using reservoir solution containing 30% ethylene glycol and flash cooled in liquid N₂. Diffraction data were collected at beamlines I04 and I04-1 at the Diamond Light Source, UK. Datasets used for structure solutions were collected from crystals grown in the following crystallisation conditions:

S2^WT-A3-ELF: 50 mM HEPES pH 7.0, 13% w/v PEG 8000.

S2^WT-A11-ELF: 0.1 M Amino acids (0.02 M Sodium Glutamate; 0.02 M Alanine; 0.02 M Glycine; 0.02 M Lysine hydrochloride; 0.02 M Serine), 0.1 M Buffer system 1 (Imidazole; MES monohydrate) pH 6.5, 50% Precipitant mix 2 (20% v/v Ethylene glycol; 10% w/v PEG 8000).

S2¹⁹⁸-A3-ELF: 50 mM MOPS pH 6.7, 14% w/v PEG 8000.

S8^WT-A3-ELF: 50 mM Magnesium acetate, 20 mM MOPS pH 7.2, 50 mM Sodium chloride, 12% w/v PEG 8000.

S8^9F3-A11-ELF: 150 mM Magnesium acetate, 20 mM MOPS pH 7.2, 12% w/v PEG 8000.

The diffraction data were integrated and scaled using the xia2⁵⁹ automated processing pipeline implementing XDS⁶⁰ and XSCALE for S2^WT-A3-ELF, S2^WT-A11-ELF, S8^WT-A3-ELF, and S8^9F3-A11-ELF datasets. The diffraction data was integrated and scaled using the xia2⁵⁹ automated processing pipeline implementing DIALS⁶¹ for S2¹⁹⁸-A3-ELF dataset. All the structures were solved using molecular replacement using Phaser⁶² within the CCP4 suite⁶³. For the S2^WT, alpha chain model from PDB 5BRZ and beta chain model from PDB 5XOT were used as search models. For the S8^WT, PDB 5BRZ was used as search model. For HLA-A*0301 and HLA-A*1101, PDB 3RL1 and PDB 1Q94 (without the peptides) were used as search models, respectively. The model was built using iterative cycles of manual model building in COOT⁶⁴ and refinement using Refmac⁶⁵. The stereochemical properties and validation of the models were assessed using PDB-REDO⁶⁶ and molprobity⁶⁷. Data collection and refinement statistics were given in Table 3. Buried surface area and TCR docking geometry statistics based on those described previously⁶⁸ were generated using Molecular Operating Environment (Chemical Computing Group). The structural figures were generated using Pymol (Schrödinger).

Generation of scHLA libraries

Peptide HLA libraries were generated in a single chain format with peptide-β2m-HLA-A*03:01 or HLA-A*11:01 displayed on the surface of phage as disulfide trapped single chain trimers. Briefly, a randomized 9-mer peptide library consisting of 1 × 10¹⁰ peptide diversity was synthesized (Twist Biosciences) and cloned into a phagemid scHLA construct using a pelB leader sequence and C-terminal coat protein pIII⁹. This phagemid library was introduced by electroporation into E. coli TG1 cells with KM13 helper phage to enable monovalent display with an estimated library size of 6.6 × 10⁹ colonies⁶⁹. Diversity was confirmed post electroporation by next generation sequencing of the initial library. This confirmed that all 20 amino acids were represented at every position with a flat distribution of 5% (max 5.8%, min 4.5%).

Panning of scHLA libraries with S8 TCRs and next generation sequencing analysis

Streptavidin-coated paramagnetic beads (Dynabeads™ M-280, Thermo Fisher Scientific) were saturated with biotinylated S8^WT or S8^9F3 and phage selections were performed as described previously⁹. Phagemid DNA was isolated from glycerol stocks of panning outputs by miniprep (Qiagen). Region of interest encompassing a synthetic 9-mer peptide sequence and the HLA-A*03:01/-A*11:01 variable segment was amplified by 15 cycles of PCR. Dual indices and adapters for Illumina sequencing were added by second round of PCR using high fidelity DNA polymerase (NEBNext Ultra II Q5 Master Mix) and multiplex oligos (NEBNext Multiplex Oligos for Illumina (Dual Index Primers Set 1)). Final libraries were cleaned up and size selected using 0.7x volume of AMPure XP beads (Beckman Coulter). Libraries were pooled at equimolar ratios, spiked with 10% PhiX and paired end (PE) sequenced (2 × 300 bp) on MiSeq (MiSeq 600 cycles v3 kit, Illumina).

Following quality based trimming and filtering of raw PE reads using BBDuk with parameters qtrim = r, trimq = 20, minlength = 80 (BBMap), sequences coding for 9-mer peptides were extracted using Cutadapt⁷⁰ from R1 reads and associated HLA allele sequences from R2 reads. For each unique combination of peptide and HLA allele, reads were tallied to obtain peptide/allele counts. For S8^WT, following two rounds of panning 208,366 reads passed QC and were mapped to either HLA-A*03:01 or HLA-A*11:01, which encoded 6,393 and 4,007 unique peptides respectively. For the affinity enhanced variant S8^9F3, following two rounds of panning, 453,116 reads passed QC and were mapped to either HLA-A*03:01 or HLA-A*11:01, which encoded 23,598 and 16,192 unique peptides respectively.

The 100 most enriched peptides from each variant were clustered based on their amino acid similarity averaged across all positions. A distance matrix was generated based on pairwise distance and defined as the average of the BLOSUM scores when each position is compared between the two peptides and visualised using tSNE. For example, to compare a peptide 123,456,789 to another peptide abcdefghi, we take the average BLOSUM62 scores for the first position (1 vs. a = Z), second position (2 vs. b = C), and so on. A heatmap of the distance matrix was generated and then the values were used to run a tSNE clustering procedure. Cluster identification was performed using HDBscan⁷¹ and three clusters were identified for each TCR and reported as sequence logos.

Engineering human TCR-null NFAT-Luciferase jurkat cells

To prevent mispairing between the introduced TCR α and β chain and the endogenous TCR α and β chain, endogenous TCR genes were inactivated in NFAT-Luciferase Jurkat cells (Promega) using CRISPR-Cas9 by knocking out both alpha and beta TCR constant chains. More specifically, cells were sequentially electroporated with Cas9 protein (Thermo Fisher) along with synthetic gRNAs (sgRNA) (Thermo Fisher) against alpha (AGAGTCTCTCAGCTGGTACA) and beta (GGAGAATGACGAGTGGACCC) constants chains. For optimal editing, 200,000 cells were electroporated with 240ng sgRNA and 1250ng Cas9 protein using Neon Transfection System (Thermo Fisher) according to manufacturer`s instructions.

Cells were screened for the absence of surface CD3 (BD Bioscience, Clone SKY7, BB515), TRBC1 (Novus Biologicals, Clone JOVI.1, PE) expression by flow cytometry. TCR null cell population were single cell sorted to achieve monoclonality. Absence of wild type sequences and the presence of indels were confirmed by sanger sequencing followed by sequence trace decomposition using CRISP-ID (http://crispid.gbiomed.kuleuven.be/) and TIDE (https://tide.nki.nl/).

Lentiviral transduction of TCR-null jurkat cells

15 million HEK-293T cells were transfected with 10 µg TCRαβ lentiviral expression construct, 12 µg pRSV.REV, 12 µg pMDLg and 12 µg pMDg.2 using PEI-Max (Polysciences) following manufacturer`s protocol. Lentiviral supernatant was collected at 72 h after transfection, spun down at 500 g for 10 min and clarified through a 0.45-µm syringe filter. Cleared supernatant was precipitated with Lenti-X concentrator (Takara-Clontech) according to manufacturer`s instructions and incubated overnight at 4°C. Samples were centrifuged next day at 1500 g for 3 h at 4°C. The pellet containing lenti-viral particles was gently resuspended in complete RPMI medium and added to Jurkat cells in RPMI medium containing 10% FBS and 12 µg/ml polybrene (Merck) Samples were centrifuged at 700 g for 2 h at 32°C. Three days after viral transduction, cells were analysed for cell surface CD3 to measure transduction efficiencies.

Flow Cytometry and cell sorting

Flow cytometric analysis was performed on BD LSRFortessa X-20 Cell Analyzer. Surface staining for flow cytometry was performed pelleting cells at 400 g for 5 min and resuspending in 50 µl of FACS buffer (5% FBS in PBS) with antibodies and viability dye for 30 min at 4 °C in the dark. Cells were washed once in FACS buffer before resuspension.

To enrich CD3+ cells post transduction, 2–5 million cells were stained with viability dye (1/1000) (eFluor780) and with anti-human CD3 antibody (1/100), (BD Bioscience, Clone SKY7, BB515) or TRBC1 (1/100) (Novus Biologicals, Clone JOVI.1, PE). Cells were then sorted on a BD FACSAria Fusion platform for live CD3+ cells. The sorted Jurkat cells were recovered and expanded in RPMI medium with 10% FBS, 2mM L-glutamine, 1mM sodium pyruvate, 1X MEM non-essential amino acid solution and 200 mg/ml hygromycin.

Artificial antigen presentation cells (aAPCs)

SPHERO™ Streptavidin 4.0–4.5 μm magnetic particles (Spherotech) were coated with 18 pM biotinylated anti-CD28 antibody (BioLegend) and varying concentrations of refolded pHLA complexes (10-fold dilutions from 18 pM) in PBS for 1 h at 4 °C. Coating was followed by two washes of PBS and resuspension in assay medium (RPMI-1640 medium containing 10% fetal bovine serum, NEAA and Sodium pyruvate (Gibco)).

Functional analysis of TCR + jurkat cells

TCR-null NFAT-Luciferase Jurkat cells transduced with either S8^WT or S8^9F3 were co-cultured with aAPC targets at a 1:1 E: T ratio and incubated at 37 °C, 5% CO₂ for 6 h in opaque, white plates. Bio-glo luciferase assay substrate (Promega) was then added to the co-culture plate according to the manufacturer’s instructions. NFAT activity was determined by measuring luminescence using a Clariostar plus plate reader (BMG LabTech). NFAT activity was normalised to unstimulated controls. Statistical analyses were performed using GraphPad Prism. Data are displayed as the mean ± SEM and were analysed using a paired t test with Wilcoxon matched pairs signed rank test.

• SEO Powered Content & PR Distribution. Get Amplified Today.
• PlatoData.Network Vertical Generative Ai. Empower Yourself. Access Here.
• PlatoAiStream. Web3 Intelligence. Knowledge Amplified. Access Here.
• PlatoESG. Carbon, CleanTech, Energy, Environment, Solar, Waste Management. Access Here.
• PlatoHealth. Biotech and Clinical Trials Intelligence. Access Here.
• Source: https://www.nature.com/articles/s41598-024-75140-7