Search
Close this search box.

Bio-distribution and toxicity potential of human umbilical cord mesenchymal stem cells in cynomolgus monkeys – Scientific Reports

Cells

hUC-MSCs at GMP-grade quality were provided by Sinoneural Cell Engineering Group Co., Ltd. and stored in liquid nitrogen away from light. The stem cells were recovered and using solvent (saline containing 5% DMSO and 5% human blood albumin, the DMSO was further diluted and the final concentration in the cell suspension was 0.25%), and were adjusted to a certain concentration before use, and the viability was estimated as 89.00% ± 3.43%.

Animals

A total 34 of cynomolgus monkey (Macaca fascicularis) aged 3–4 years were purchased from Guangdong Blue Island Biotechnology Co., Ltd. (Experimental animal production license number: SCXK [Yue] 2019–0010). The the body masses of females ranged from 2.50 to 3.25 kg, and the body masses of males ranged from 2.55 to 3.80 kg. The temperature of the rearing room was 16–26 °C, the relative humidity was 40–70%, and the lighting time was 12 h/day. All animal experimental procedures were approved by the Institutional Animal Care and Use Committee (IACUC) of the National Center for Safety Evaluation of Drugs (No. IACUC-2020–069). The study is presented in accordance with Animal Research: Reporting of In Vivo Experiments (ARRIVE) guidelines.

Groups and administration

There are four animals used in the bio-distribution study with DiR, and 30 animals in the toxicity study. All the cynomolgus monkey for the toxicity study were randomlised into 3 groups, including Control Group, Low-dose Group and High-dose Group, with 5 males and 5 females in each. These animals were administered intravenously (intravenous infusion at 3 mL/min) with solvent or hUC-MSCs at 3 × 106 cells/kg or 2 × 107 cells/kg at 10 mL/kg for once a week for 4 consecutive weeks (five times in total), and a 4-week recovery period was set after the last administration.

The intended clinical dose of hUC-MSCs is 1 × 106 cells/kg. In terms of kilogram body weight, the low dose (3 × 106 cells/kg) and high dose (2 × 107 cells/kg) used in this study was 3 times and 20 times the clinical equivalent dose, respectively.

Bio-distribution of hUC-MSCs with DiR

hUC-MSCs were rinsed with PBS for twice before use. Dye of 1, 1′-dioctadecyl-3,3,3′,3′-tetramethylindotricarbocyanine iodide (DiR, Caliper Life Sciences) was diluted to 5 μg/mL andmixed with the hUC-MSCs (for 1 × 106 cells, 1 mL of DiR dye was required). The mixture was incubated in a 37 °C incubator for 30 min, and the supernatant was removed by centrifugation at 400 g for 5 min. The cells were rinsed again in PBS for twice by centrifugation. Four monkeys were used in this study. DiR-labeled hUC-MSCs were administered to monkeys by a single intravenous injection at doses of 3 × 106 cells/kg or 2 × 107 cells/kg respectively. Peripheral blood of 500 μL was collected at before, 0.083 h, 0.25 h, 0.5 h, 1 h, 2 h and 3 h, 1, 2, 3, 5, 7, 10, 14, 21, and 28 days post-administration to determine the distribution of hUC-MSCs in blood using FACS Calibur flow cytometry (Becton, Dickinson and Company, U.S.A). In the single administration study, hUC-MSCs were labeled with near-infrared dye DIR, and the metabolic characteristics of hESC-MSCs in the blood of cynomolgus monkeys were continuously and dynamically detected by flow cytometry.

Repeated dosed toxicity of hUC-MSCs

See Fig. 1 for detailed study schedule. Clinical symptoms were observed daily, observing the appearance, coat, activity, neurological signs, respiratory status, and body posture.All injection sites were examined for redness, swelling, induration, suppuration and necrosis. Body mass was measured with a floor scale. Body temperature was measured by anal thermometer. The electrocardiogram (ECG) was recorded, and the indicators were calculated on the basis of the ECG recording, including heart rate, PR intervals, RR intervals, QRS durations, QT intervals, corrected QT intervals (QTc). Blood pressure was determined by non-invasive sphygmomanometry, including systolic blood pressure (SBP), diastolic blood pressure (DBP), and mean blood pressure (MBP). Urinalysis (including glucose, protein, bilirubin, urobilinogen, pH, specific gravity, occult blood, ketones, nitrite, white cell, and color) were performed using an AUTION AE-4020 automated urine chemistry analyzer. Blood was collected from a forearm vein. Hematologic analysis was performed using an ADVIA 2120 analyzer (Siemens; Munich, Germany), including white blood cell count (WBC), neutrophil count (Neut), lymphocyte count (Lymph), monocytecount (Mono), eosinophil count (Eos), basophil count (Baso). Serum was isolated and used for biochemical analysis using the automatic biochemical analyzer (7180, Hitachi, Japan), including alanine aminotransaminase (ALT), spartate aminotransaminase (AST), alkaline phosphatase (ALP), creatine kinase (CK), gamma glutamyl transpeptidase (GGT), lactate dehydrogenase (LDH), total bilirubin (TBIL), urea nitrogen (UREA), creatinine (CRE), glucose (GLU), total cholesterol (CHO), triglyceride (TG), total protein (TP), albumin (ALB), albumin/globulin ratio (A/G), serum potassium (Na+), serum natrium (K+), serum chlorine (Cl), IgA, IgG, IgM, C3, and C4. Immunophenotyping of T lymphocyte was assessed by flow cytometry, including CD3+/CD4+T lymphocyte, CD3+/CD8+T lymphocyte, CD4+/CD8+ ratio, CD4+CD25+Foxp3+ regulatory T cells (Treg). Flow cytometry was establishedto test the immunogenicity of stem cells (Fig. 2). hUC-MSCs were incubated with diluted serum samples for 30 min before incubating with goat anti rhesus IgG (H + L) antibody for the detection of anti-hUC-MSCs binding antibodies. The levels of TNF-α, IFN-γ, IL-2, IL-4, IL-5, and IL-6 in monkeys serum were evaluated by a BD Human Th1/Th2 Cytokine Kit II (BD, U.S.). The monkeys were anesthetized with an intramuscular injection of Zoletil 50 (0.1 mL/kg). Gross and histopathological examinations were performed, including: brain, pituitary gland, thyroid gland (with parathyroid glands), submandibular gland, spinal cord (cervical, thoracic, lumbar segment), thymus gland, sternum (bone marrow), heart, aorta, tongue, trachea, oesophagus, lungs (with bronchus), liver, gallbladder, kidneys, adrenal glands, spleen, pancreas, stomach, duodenum, jejunum, ileum, cecum, colon, rectum, testes, epididymis, prostate gland, seminal vesicles, ovaries, fallopian tubes, uterus (with cervix), vagina, bladder, bone (unilateral thigh bone), sciatic nerve, muscle (skeletal muscle), skin, mammary glands (females only), eyeballs, optic nerves, mesenteric lymph nodes, inguinal lymph nodes, site of injection, and site of lesion. Tissues and organs weighed include: brain, thyroid (including parathyroid), thymus, heart, lungs (including bronchi), liver, kidneys, adrenal glands, spleen, testes, epididymis, ovaries, uterus (with cervix).

Figure 1
figure 1

Study schedule of toxicity study. hUC-MSCs were repeated administered to monkeys on D1, D8, D15, D22, and D29, respectively. *For bio-distribution, blood samples were collected on D1 (at before, 0.083 h, 0.5 h, 1 h, and 3 h), D3, D5, and D7, and D19 (at 0, 0.083 h, 0.5 h, 1 h, and 3 h), R1, R3, R5, R7, R10, R14, and R29. Clinical symptoms were observed every day, a body weight were measured every week. Body temperature was determined on the day and the following day of administration. ECG and blood pressure were measured on D1, D2, D15, D16, D28, R28. Urinalysis was performed on D5, D16, D28, and R28.Blood samples were collected on D3, D17, D29, and R29 for hematology, biochemistry, T lymphocyte subsets detection, respectively. Antibodies for hUC-MSCs were detected on D8, D15, D29, and R29. Animals were anesthetized on D29 and R29 for gross and histopathological examination.

Figure 2
figure 2

The Flow cytometry test for anti-stem cell antibodies. Animal serum samples were collected at different time points, diluted and incubated with stem cells. Subsequent to the addition of labeled secondary antibodies, flow cytometry was used to detect the presence of anti-stem cell antibodies in the samples.

In addition, peripheral blood of 300 μL was collected at before, 0.083 h, 0.5 h, 1 h, 3 h, 1, 3, 5, and 7 days post the first administration, as well as before, 0.083 h, 0.5 h, 1 h, 3 h, 1, 3, 5, 7, 10, 14, and 29 days post the final administration. Tissue samples of blood, heart, liver, spleen, lungs, kidneys, brain, testes, epididymides, uterus, ovaries, stomach, intestine, fat, and skeletal muscle were collected, and the distribution of hUC-MSCs in blood was detected by Q-PCR method. DNA is extracted from various tissues using a blood and tissue kit (Qiagen, U.S.) and the concentration of elution DNA is adjusted to the actual range. The upstream and downstream primer sequences are “TGTCTTTTTCTTGTTTTGGAGGAA” and “CCAGACCACCCATAATCTTGTGT”, respectively, and the probe sequences are “AGGAGCCCATCGGG”. The primers above were designed and synthesized by Shanghai Shenggong Biological Engineering Co., Ltd. PCR reaction conditions were: 95 °C for 10 min, followed by 40 cycles of 95 °C for 15 s and 60 °C for 60 s. In this study, we used a TaqMan assay, in which a pair of primers and a specific fluorescent oligonucleotide probe was used. For each sample, three replicates were analyzed and the average of these replicates was calculated. Prior to PCR assay, DNA concentrations were measured with NanoDrop One to obtain genomic DNA content, and these concentrations were used to calculate the number of gene copies per nanogram of genomic DNA.

Animals were anesthesia by 35 mg/kg pentobarbital sodium, blood collection and necropsy were performed in a specific order (the Control Group, followed by the Low-dose Group and High-dose Group) to minimize potential confounders.

Statistical analysis

All data are presented as the mean ± standard deviation (SD) of n values, where n corresponds to the number of mice used. Statistical analyses were performed using one-way ANOVA, followed by Dunnett’s test for comparisons to the Control group. Figures were generated using GraphPad Prism 5 for Windows (GraphPad Software, San Diego, CA, USA). Statistical significance was determined using SPSS (ver.26), with p < 0.05 considered significantly different.

Ethical statement

The authors are accountable for all aspects of the work in ensuring that questions related to the accuracy or integrity of any part of the work are appropriately investigated and resolved. All animal experimental procedures were approved by the Institutional Animal Care and Use Committee (IACUC) of the National Center for Safety Evaluation of Drugs (NCSED, IACUC approval No. IACUC-2018–K001), in compliance with the IACUC Constitution of NCSED, the Guide for the Care and Use of Laboratory Animals (https://grants.nih.gov/grants/olaw/Guide-for-the-Care-and-use-of-laboratory-animals.pdf) and AAALAC International’s Position Statement. All study protocols (including the research question, key design features, and analysis plan) were prepared before the study and archived at National Center for Safety Evaluation of Drugs.