Antibody-dependent enhancement of toxicity of myotoxin II from Bothrops asper – Nature Communications

Protocols for in vivo experiments were approved by the Institutional Committee for the Use and Care of Animals (CICUA), University of Costa Rica (approval number CICUA 84–17).

Purification of myotoxin II

Myotoxin II (Uniprot P24605) was purified from the venom of Bothrops asper by cation-exchange chromatography on CM-Sephadex C25, followed by reverse-phase HPLC on C₁₈^7,8. In brief, for cation-exchange on CM-Sephadex C25, venom was dissolved in 0.1 M Tris, 0.1 M KCl (pH 7.0) and applied to the CM column (20 × 2 cm) equilibrated in the same buffer, and monitored at 280 nm. After elution of unbound proteins at 0.4 mL/min, a linear gradient towards 0.1 M Tris, 0.75 M KCl (pH 7.0) was applied. The last eluting peak was collected, and aliquots of this fraction were then applied to a semi-preparative RP-HPLC C8 column (250 × 10 mm), equilibrated with solution A (0.1% trifluoroacetic acid in water). Elution was performed at 2.5 mL/min, monitored at 215 nm, using a linear gradient towards solution B (0.1% trifluoroacetic acid in acetonitrile). Myotoxin-II was collected, lyophilized, and stored at −20 °C until use. Protein identity was confirmed by determining the deconvoluted monoisotopic intact mass to match with its amino acid sequence (P24605) by direct infusion in a Q-Exactive Plus (Thermo) mass spectrometer.

Biotinylation of myotoxin II

Lyophilized myotoxin II was solubilized in phosphate-buffered saline (PBS) and mixed with biotin linked to N-hydroxysuccinide (NHS) via a PEG₄ linker (EZ-Link^TM NHS-PEG₄-Biotin, Thermo Scientific, #A39259) in a molar ratio of 1:1.5 (toxin:biotin) and incubated at room temperature for 30 min. For purification of the biotinylated myotoxin II, buffer exchange columns (Vivacon 500, Sartorius, 3000 Da Molecular Weight Cut-Off) were used following the manufacturer’s protocol. The final concentration of biotinylated myotoxin II was measured at 280 nM using a Nanodrop Spectrophotometer (NanoDrop One^C Spectrophotometer, Thermo Scientific).

Phage display selection and assessment of polyclonal output

For phage display selection, the IONTAS phage display library λ was employed, which is a naïve human antibody phage display library with a clonal diversity of 1.6 × 10¹⁰. The displayed antibodies come in the form of scFvs and have been constructed from B lymphocytes collected from 43 non-immunized human donors²⁹.

Phage display selection was carried out as earlier described²⁹, with the following modifications described briefly: For selections, biotinylated myotoxin II (10 µg/mL) was captured on streptavidin-coated (10 µg/mL) Maxisorp vials. In the second and third selection round, neutravidin was used instead of streptavidin to prevent accumulation of streptavidin-recognizing antibodies. Elution in the third round was carried out by incubating with a 10 mM glycine-HCL solution at pH 6 for 15 min instead of eluting with trypsin.

After three rounds of phage display selection, antigen specificity of the phage output was evaluated. This was carried out according to Føns et al.⁴⁰, using a similar protocol to the phage display selections. The phage output was purified utilizing polyethylene glycol precipitation²⁹, and binding was tested against Maxisorp vials coated with either (i) biotinylated myotoxin II indirectly immobilized using streptavidin, (ii) streptavidin, or (iii) 3% (w/v) skimmed milk in PBS (M-PBS). Biotinylated myotoxin II and streptavidin were used at a concentration of 10 µg/mL.

Sub-cloning, primary screening, and sequencing of scFvs

To express soluble scFvs, the scFv genes from the third selection round were sub-cloned from the phage display vector (pIONTAS1) into the pSANG10-3F expression vector using NcoI and NotI restriction endonucleases. The expression vectors were then transformed into E. coli BL21(DE3) cells (New England Biolabs), following protocols from Martin et al.⁴¹. Individual scFv-producing monoclonal colonies (276 colonies) were picked and expressed in 96-well format using auto-induction media⁴². To determine the binding of the scFvs to myotoxin II, a monoclonal scFv ELISA was carried out. 96-well Maxisorp plates with biotinylated myotoxin II (5 µg/mL) captured on streptavidin (10 µg/mL) were used. For detection of binding, a 1:20,000 dilution of anti-FLAG M2-Peroxidase (HRP) (Sigma Aldrich, #A8592) antibody in 3% M-PBS was used followed by the addition of an OPD solution (Sigma-Aldrich, P5412) as substrate according to the manufacturer’s protocol. A biotinylated RP-HPLC purified fraction from Naja mossambica venom containing PLA₂ was included as a negative control antigen. Additional controls included wells coated with streptavidin/neutravidin (10 µg/mL) and 3% M-PBS. Binding was measured as absorbance at 492 nm using an Epoch spectrophotometer from Biotek (15020518) with the Gen5 2.07 software.

The genes encoding scFvs binding specifically to myotoxin II with absorbance (492 nm) values above a pre-set threshold of 0.2 were sequenced (Eurofins and Macrogen genomics sequencing service) using the S10b primer (GGCTTTGTTAGCAGCCGGATCTCA). The antibody framework and CDR regions were annotated and analysed using the Jalview 2.10.5 software and Abysis.org program to identify unique scFvs.

Expression-Normalized Capture (ENC) DELFIA

Black MaxiSorp plates (Nunc) were coated overnight with anti-FLAG M2 antibody (Sigma, F1804 − 2.5 µg/mL in PBS) at 4 °C. Following blocking, 123 individual supernatants⁴² containing monoclonal FLAG-tagged scFvs in 3% M-PBS were added. Next, antigens were introduced at a concentration of 10 nM followed by detection of binding using europium-labeled streptavidin (PerkinElmer 1244–360, 200 ng/mL) in DELFIA assay buffer (PerkinElmer 4002–0010), and DELFIA enhancement solution (PerkinElmer 4001–0010). Binding was measured as Time-Resolved Fluorescence (TRF) using a FLUOstar Omega reader with excitation and emission wavelengths of 337 nm and 615 nm, respectively, and 400 µs as both integration start and integration time.

Conversion from scFv to antigen-binding fragment (Fab) format

The V_L and V_H sequences from E02 were cloned into the pINT12 expression vector containing the respective heavy chain constant domains and light chain constant domain. The individual variable domains were PCR amplified from the pSANG10-3F vector using LLINK2_F (CTCTGGCGGTGGCGCTAGC) and 2097_R (GATGGTGATGATGATGTGCGGATGCG) for the V_L, and pSang10_pelB (CGCTGCCCAGCCGGCCATGG) and HLINK3_R (CTGAACCGCCTCCACCACTCGA) for the V_H. The PCR amplicons were prepared by digestion with NheI and NotI (V_L digestion) and NcoI and XhoI (V_H digestion) endonucleases. A four-part ligation, including both variable domains, the pINT12 vector containing the respective heavy chain constant domains, and a stuffer region containing the C_L and CMV promoter cut with NcoI and NotI, was performed with T4 DNA ligase (Roche, 10481220001).

For B12, the variable chains (V_L and V_H) were amplified from the pSANG10-3F vector by PCR and cloned into a single expression vector using the NEBuilder® cloning technique. The expression vector contained the constant heavy domain 1 and constant light domain sequences of human IgG1. The constant heavy domain 1 (ending on VEPKSC) was extended with three alanine residues and six histidine residues for purification purposes. Following transformation and sequence verification the plasmids were used for production.

Production of Fabs

The E02 Fab was produced by transient mammalian expression using a ratio of 1 µg DNA/mL Expi293F^TM cells (Life Technologies^TM, A14527) with ExpiFectamine^TM 293 (ThermoFisher, A14525) as per the manufacturer’s guidelines. Transfected cells were incubated for 4 days in an orbital shaker at 37 °C, 5% CO₂, 70% humidity with 1000 rpm shaking, followed by cell harvesting and purification of the Fab from supernatants using anti-C_H1 resin (Thermo Scientific, 194320010). The supernatant was incubated overnight with 100 µL of anti-C_H1 resin diluted 5-fold in PBS and afterward transferred to a Unifilter membrane (GE Healthcare, 7700-2804) and loaded onto a 96 deep well microplate. In centrifugation intervals of 1 min, 1000 × g, the flowthrough was removed, then the resin was washed twice with 500 µL PBS, and the Fab was eluted with 75 µL, 0.2 M Glycine, pH 2.6 into a new plate containing 25 µL of 2 M Tris pH 8.0 neutralization buffer. Finally, the Fab was desalted using Zeba Spin Desalting plates (Thermo Scientific, 89808) into PBS.

The B12 Fab was expressed by transfection of ExpiCHO cells, which were cultured and transfected according to the manufacturer’s guidelines (Gibco™). The protocol included addition of ExpiFectamine™ CHO Enhancer and a single feed at Day 1 and cells were maintained at 37 °C and 5% CO₂. The supernatant was collected at Day 7 by removal of the cells through centrifugation at 300 g for 5 min, followed by an additional centrifugation at 1000 g for 5 min and storage at −80 °C. After thawing overnight at 4 °C, the supernatant was centrifuged once more, and the His-tagged protein was purified by immobilized metal ion affinity chromatography employing a 5-mL HisTrap Excel column (Cytiva). Fractions of interest were pooled, and the volume reduced by centrifugal filtration using an Amicon Ultra-15 centrifugal filter unit (10 kDa NMWL). The protein solution was subjected to size-exclusion chromatography by injection on a HiLoad 16/600 Superdex75 column (Cytiva) using Dulbecco’s PBS as eluent. Fractions of interest were pooled, sterile-filtered, concentrated and subjected to endotoxin-removal using Pierce High-capacity endotoxin removal spin columns. The final concentration was determined by measuring the absorbance at 280 nm on a Nanodrop2000 instrument. Purity was checked by SDS-PAGE. The purified protein was stored at −80 °C.

Conversion from scFv to IgG format and IgG production

Antibody variable domains were converted from scFv to IgG format prior to expression in CHO-S cells. The variable chains (V_L and V_H) were extracted from the pSANG10-3F vector by PCR and were cloned into a single expression vector using the NEBuilder® cloning technique. The expression vector contained the constant domain sequences of the respective human IgG heavy chain (with LALA²³ mutation, or LALA and YTE²⁴ mutations) and human lambda light chain. For production of IgG (LALA + YTE), a CHO-S cell line with pre-established landing pad suitable for recombinase-mediated cassette exchange with the IgG expression vector was cultivated in CD CHO medium (Gibco), supplemented with 8 mM L-Glutamine (Thermo Fisher Scientific) and 2 µL/mL anti-clumping agent (Gibco) at 37 °C, 5% CO₂ at 120 rpm (shaking diameter 25 mm). The cell line was transfected with IgG expression vector and Cre-recombinase vector in 3:1 ratio (w:w) in 6-well plates (BD Biosciences) at a concentration of 10⁶ cells/mL using FreeStyle MAX transfection reagent (Thermo Fischer Scientific) according to the manufacturer’s recommendation. Stable cell pools were generated by adding 5 µg/mL blasticidin five days post-transfection, continuing until cell death of untransfected cells and complete recovery of transfected cells (>95% viability). IgG producing cell pools were seeded at 3 × 10⁵ cells/mL in FortiCHO or CD CHO medium supplemented with 8 mM glutamine and 2 µL/mL anti-clumping reagent. The pools were cultivated in batch mode (CD CHO) for 5 days or in fed-batch mode (Forti-CHO) for 7 to maximum 13 days, feeding glutamine, glucose, and feeding supplements cell boost 7a and 7b (VWR) starting on either day 3, 4, or 5. Cultures were harvested by centrifuging the cell suspension at 300 × g for 10 min followed by 4700 × g for 15 min, removing cells and cell debris. Clarified supernatants were stored at −80 °C until purification. The production of IgG (LALA) was carried out using transient transfection of ExpiCHO cells as described for the B12 Fab above.

Purification of IgGs

Supernatant was thawed overnight at 4 °C, centrifuged, filtered, and loaded on a MabSelect column (Cytiva). 20 mM sodium phosphate and 150 mM NaCl (pH 7.2) was used for equilibration, and washing of the column and elution was performed with 0.1 M sodium citrate (pH 3). Elution fractions were immediately neutralized by 1 M Tris (pH 9) using 1/5 volume of neutralization solution for 1 volume of elution fraction. Fractions of interest were pooled and loaded on a HiPrep 26/10 desalting column for buffer exchange to Dulbecco’s PBS. Protein fractions were sterile-filtered and concentrated by centrifugal filtration using an Amicon® Ultra-15 centrifugal filter unit (30 kDa NMWL). The final concentration was determined by measuring the absorbance at 280 nm on a Nanodrop2000 instrument. Purity was checked by SDS-PAGE. The purified protein was stored at −80 °C.

Monoclonal IgG ELISA

A monoclonal IgG dose-response ELISA was set up to test whether the binding properties of the scFv were retained after reformatting to the IgG1 format. Biotinylated myotoxin II (5 µg/mL) was captured in streptavidin-coated (10 µg/mL) MaxiSorp plates (Nunc) and blocked with 3% M-PBS. Next, the antibodies were serial diluted (6.85 nM, 3.42 nM, 1.71 nM, 0.85 nM, 0.43 nM, and 0.21 nM) in 3% M-PBS and added in triplicates to the plates. For detection of binding, a 1:10,000 dilution of Anti-Human IgG (Fc-specific)-Peroxidase antibody (Sigma-Aldrich, A0170) in 3% (w/v) skimmed milk in PBS was utilized along with a 3,3′,5,5′-Tetramethylbenzidine (TMB) substrate kit (Thermo Scientific, #34021). Absorbance was measured at 450 nm in a Multiskan FC Microplate Photometer (Thermo Scientific). Prior to carrying out the IgG ELISAs, the antibody concentration in the supernatants was determined using an Octet® R8 (Sartorius) with proteinA biosensors. Sensors were hydrated and neutralized in 1x PBS while sensors were regenerated using a 10 mM glycine pH 1.7 buffer. Incubation lasted for 5 min with 1000 rpm shaking speed. The standard curve covered concentrations from 0.78 to 200 µg/mL and was diluted from a concentrated (10 mg/mL) stock of the antibody rituximab that was produced in-house.

Human fibroblast assay

An in vitro neutralization assay to assess cell viability was carried out using human dermal fibroblasts (neonatal; 106-05 N, Sigma Aldrich) based on the CellTiter-Glo® Luminescent Cell Viability Assay (Cat.# G7571, Promega, USA). First, the IC₅₀ of myotoxin II was determined on fibroblasts (29 µg/mL) and subsequently IgGs were assessed for their neutralizing abilities against 2.5 IC₅₀s of myotoxin II (72.5 µg/mL). The level of neutralization was tested at toxin:IgG molar ratios of 1:0.5, 1:1, and 1:1.5.

The assay was carried out according to the manufacturer’s protocol over a span of three consecutive days and all experiments were run in triplicates: On the first day, 100 µL of cells (400,000 cells/ mL in fibroblast culture medium) were seeded in 96-well plates and grown for 24 h at 37 °C/5% CO₂. After 24 h of incubation, the toxin, or toxin-IgGs mixtures (preincubated 30 min at 37 °C) were added to their respective wells. Following 24 h of incubation (37 °C/5% CO₂), the wells were emptied and 100 µL CellTiter-Glo® Reagent (room temperature) was added to each well and the plates were incubated 5–10 min on an orbital shaker. After 10 min at room temperature, the luminescence was recorded (Victor Nivo, Perkin Elmer).

Bio-layer interferometry measurement

1x Kinetic Buffer (KB, ForteBio) prepared in PBS was used as the running buffer in the bio-layer interferometry experiments (Octet, Sartorious). Prior to the assay, the streptavidin (SAX) biosensors were pre-wet for 10 min in 1x KB. Kinetic assays were performed by first capturing biotinylated myotoxin II using SAX biosensors followed by a 120 s baseline step in 1x KB. The myotoxin II-captured biosensors were then dipped in wells containing increasing concentrations of Fab or IgG – 0 nM, 1 nM, 10 nM, and 100 nM for a 600 s of association step, followed by a dissociation step in 1x KB for 600 s. The experiment was performed at 30 °C with a shaking at 1000 rpm. ForteBio’s data analysis software was used to fit the binding curves using a 1:1 binding model to determine the k_on, k_off, and K_D except for G08, which was fitted using a 2:1 heterogeneous ligand model, which assumes two sets of rate constants. This 2:1 heterogeneous ligand model was picked because of the biphasic nature of the association curves, where an initial fast on-rate was followed by a slower on-rate, instead of reaching an equilibrium.

Animals

Animal experiments were conducted using CD-1 mice of both sexes weighing 18–20 g (corresponding to 3–4 weeks old). Mice were supplied by Instituto Clodomiro Picado and experiments were conducted following protocols approved by the Institutional Committee for the Use and Care of Animals (CICUA), University of Costa Rica (approval number CICUA 84–17). Mice were provided food and water ad libitum and housed in Tecniplast Eurostandard Type II 1264C cages (L25.0 cm × W40.0 cm × H14.0 cm) in groups of 5 mice per cage. Animals were maintained at 18–24 °C, 60–65% relative humidity and 12:12 light-dark cycle.

In vivo mouse assay for myotoxicity neutralization

Myotoxin II was preincubated for 30 min at room temperature with either (a) phosphate-buffered saline (0.12 M NaCl, 0.04 M sodium phosphate; PBS, pH 7.2), (b) monoclonal antibody (B12, E02, and G08) at 1:1 molar ratio, or (c) polyvalent equine antivenom (batch 6720721, Instituto Clodomiro Picado) at 1.6 mg toxin/mL antivenom ratio. Subsequently, the preincubated mixtures were injected by intramuscular (gastrocnemius) route, in a total volume of 100 μL (containing 75 μg of toxin as challenge dose), in groups of five CD-1 mice. As a control, a group of mice received an identical injection of 100 μL of PBS alone. Monoclonal antibody alone, in equal amount as in the myotoxin-preincubated mixture, was injected in a group of 5 mice as an additional control. All mice were bled 3 h after injection and the plasma creatine kinase (CK) activity was determined using a UV-kinetic commercial assay (CK-Nac, Biocon Diagnostik), as an indicator of skeletal muscle necrosis⁴³.

Using the same mouse assay, it was evaluated whether monoclonal antibody B12 (153 μg), B12 Fab format (102 μg), polyvalent equine antivenom (batch 6720721, Instituto Clodomiro Picado) (29 μL), or polyvalent equine antivenom (29 μL) mixed with monoclonal antibody B12 (125 μg), could neutralize the myotoxic effects of whole B. asper venom. Venom and antibodies were preincubated for 30 min at room temperature, and then the mixtures were intramuscularly injected in groups of 5 mice (100 μL, containing 50 μg of whole venom as challenge dose), using as a control group of mice receiving PBS alone. Plasma CK activity after 3 h was determined as above.

Mouse experiments followed ethical guidelines of the Institutional Committee for the Use and Care of Animals (CICUA, #084-17) of the University of Costa Rica. Testing of statistical significance was carried out on preselected groups using one-way ANOVA followed by Šídák’s multiple comparison test.

In vivo mouse rescue assays for myotoxicity neutralization

A rescue assay using B12, polyvalent equine antivenom (batch 6720721, Instituto Clodomiro Picado) or polyvalent equine antivenom mixed with monoclonal antibody B12 was performed. B. asper venom (50 µg in 100 µL of PBS) was injected in the right gastrocnemius of groups of 5 mice. After 3 min, mice were intravenously injected with either B12 (1085 µg), polyvalent equine antivenom (200 µL), or polyvalent equine antivenom (150 µL) mixed with monoclonal antibody B12 (760 μg). A control group was injected intramuscularly with B. asper venom (50 µg in 100 µL of PBS) with no rescue injection after 3 min. Two other control groups were injected intramuscularly with PBS (100 µL), one group received an intravenous injection of B12 (1085 µg) and the other group did not receive a rescue injection. Plasma CK activity after 3 h was determined in all mice groups as above.

Another rescue assay was performed using the same methodology as above, in groups of 5 mice, but instead using the Fab format of B12 or different scaffold mutations for the B12 IgG1, meaning that the scaffold in all above experiments contained both LALA and YTE mutations, but in this experiment, it only contained the LALA mutation. B. asper venom (50 µg in 100 µL of PBS) was injected in the right gastrocnemius of groups of 5 mice. After 3 min, mice were intravenously injected with B12(LALA) (985 µg), B12 Fab (664 µg), polyvalent equine antivenom (batch 6720721, Instituto Clodomiro Picado) (200 µL), or polyvalent equine antivenom (150 µL) mixed with B12(LALA) (690 μg). A control group was injected intramuscularly with B. asper venom (50 µg in 100 µL of PBS) with no rescue injection after 3 min. A second control group was injected intramuscularly with PBS (100 µL) and did not receive a rescue injection. A third control group was injected intramuscularly with PBS (100 µL), and after 3 min, mice were intravenously injected with B12 Fab (664 µg). Plasma CK activity after 3 h was determined in all mice groups as described previously.

Histological evaluation of systemic toxicity

Heart, liver, kidney, and lung samples were obtained from groups of mice after 24 h of injection with either B. asper venom i.m. (50 µg in 100 µL of PBS) or B. asper venom i.m. (50 µg in 100 µL of PBS) followed by i.v. B12(LALA + YTE) (1085 µg) after 3 min. Tissues were fixed in 3.7% formalin, and processed for hematoxylin–eosin staining of paraffin-embedded sections.

Statistics and reproducibility

No statistical method was used to predetermine the sample sizes. The experiments were not randomized. The investigators were not blinded to allocation during experiments and outcome assessment. In the data analysis of muscle damage measurements in mice, one outlier data point was identified and removed. This data point exhibited a value over three times higher than the mean of the remaining four replicates.

Reporting summary

Further information on research design is available in the Nature Portfolio Reporting Summary linked to this article.

• SEO Powered Content & PR Distribution. Get Amplified Today.
• PlatoData.Network Vertical Generative Ai. Empower Yourself. Access Here.
• PlatoAiStream. Web3 Intelligence. Knowledge Amplified. Access Here.
• PlatoESG. Carbon, CleanTech, Energy, Environment, Solar, Waste Management. Access Here.
• PlatoHealth. Biotech and Clinical Trials Intelligence. Access Here.
• Source: https://www.nature.com/articles/s41467-023-42624-5