Acquisition of durable insulin-producing cells from human adipose tissue-derived mesenchymal stem cells as a foundation for cell- based therapy of diabetes mellitus – Scientific Reports

Isolation and expansion of human adipose-derived stem cells (ADSCs)

The research study was approved by the Ethics Committee for Medical Research of National Research Centre (Approval Number 19/109). Subcutaneous fat was obtained from twelve female donors aged between 22 and 35 years’ undergoing caesarian sections. Informed consent was obtained from all participants. Cells were dissociated from fat tissue using type I collagenase (Gibco, Cat # 17018029, USA). The isolated stromal vascular fraction (SVF) was cultured in complete medium of DMEM: F12 1:1 (Gibco, Cat # 12500062) medium supplemented with 10% fetal bovine serum (FBS), (Gibco, Cat # 12662029), 2 mM L-glutamine, and Antibiotic-Antimycotic (100X) (Gibco, Cat # 15240096), and incubated at 37 °C and 5% CO₂ humidified atmosphere, to obtain adherent cells. Non-adherent cells were washed after 72 h and adherent cells were remained in complete medium for 2 weeks. The culture medium was refreshed twice a week. After reaching nearly 70–80% confluent cells, the cells were detached using 0.25% trypsinEDTA for passaging. Cells were observed by inverted microscope examination¹⁴.

Flow cytometric analysis

Isolated ADSCs at passage 3 were trypsinzed for immune-phenotypic analysis. The cells were incubated with fluorochrome-conjugated monoclonal antibodies, according to the manufacturer’s instructions, at 4 °C for 30 min in the dark. The antibodies used were anti-human, CD90-PE, CD73-PE, CD34-PE, CD14-PE, CD105-FITC, and CD45-FITC (BD Biosciences, USA). The labeled cells were analyzed on a FACS Caliber (Becton-Dickinson, FAC scan, San Jose, CA, USA)¹⁵.

Multi-lineage differentiation potential

The isolated ADSCs were induced to differentiate into adipocytes, chondrocytes, and osteocytes, using StemPro^® adipogenesis differentiation medium, StemPro^® chondrogenesis differentiation medium, and StemPro^® osteogenesis differentiation medium (Gibco, Thermo Fisher Scientific Inc. (USA), respectively. For each protocol, differentiation medium was placed in experimental wells and standard ADSC medium in control wells. Induction was performed according to the manufacturer’s instructions. Oil-Red-O stain (Sigma-Aldrich, St. Louis, MO, USA) was used to determine adipocytes phenotype, Alcian blue stain (Sigma-Aldrich) for chondrocytes, and Alizarin-red (Sigma-Aldrich) staining was used to detect calcium deposits of osteocytes¹⁶.

Differentiation of ADSCs into IPCs

IPCs-differentiation induction was established by three different protocols.

The first protocol (P1) was implemented according to¹⁷. As MSCs were primarily potentiated using 10 mmol/L nicotinamide (Sigma-Aldrich) and 1 mmol/L β-mercaptoethanol (Sigma-Aldrich) in 10% FBS LG-DMEM (Serox, Germany) for the first 48 h. The medium was replaced by 10 mmol/L nicotinamide and 1 mmol/L β-mercaptoethanol in serum-free high glucose (HG)-DMEM (Serox) for another 24 h. Further induction for the next 7 days were performed by 10 nmol/L exendin-4 (Sigma-Aldrich) in serum free HG-DMEM supplemented with 10 mmol/L nicotinamide and 1 mmol/L β-mercaptoethanol.

The second protocol (P2) was described by¹⁸ and started with passaging of MSCs on Geltrex™ (Gibco)-coated 6-well culture plates in LG-DMEM containing 15% FBS for 24 h. The medium was replaced by HG-DMEM, containing 2% FBS and 100 ng/ml activin A (STEMCELL Technologies Inc, Canada) for the next 24 h. and then changed to HG-DMEM containing 2% FBS and 10^− 6 mol/l retinoic acid (RA; Sigma Aldrich) for an additional 24 h. Subsequently, the cells were cultured in HG-DMEM containing 2% FBS and 10 ng/ml basic fibroblast growth factor (bFGF; STEMCELL Technologies Inc) for another 3 days. The culture medium was replaced by HG-DMEM containing 2% FBS and 10 mmol/l nicotinamide for 3 days. Eventually, the cells were cultured in HG-DMEM containing 2% FBS and 10 mmol/l nicotinamide in the presence of 10 mmol/l exendin-4 for 3 days.

The third protocol (P3) was carried out according to study design previously reported by¹⁹; aliquots of 2.5 × 10⁵ cell suspension in complete culture media were plated in 5 µg/mL laminin (Gibco) pre-coated 6-well plates overnight. At stage I, the medium was replaced by fresh HG-DMEM containing 10% FBS for 3 d. The media were refreshed with DMEM/F-12 (Lonza) medium containing 2% FBS and 1% Insulin-Transferrin-Selenium-A (ITS-A, Gibco) for another 4 d. At stage III, 10 mM nicotinamide was added into the media described in stage II, and the culture lasted for 3 days. Eventually, at stage IV, the medium was removed and refreshed with a new medium containing the same supplements as at stage III, and 1% N2 and 1% B27 supplements (STEMCELL Technologies Inc) were included and incubated for 4 d.

Quantitative analysis of β cell-related genes

Total RNA was purified from induced IPCs differentiated by the three different protocols using TRI reagent and Direct-Zol RNA kit (ZYMO RESEARCH, USA) according to the manufacturer’s instruction. Furthermore, cDNA was synthesized (COSMO cDNA synthesis kit, Willowfort, UK) using 100 ng of purified RNA as a template and random hexamers with oligo (dT) primers to initiate reverse transcription reaction. Gene expression was performed for endocrine hormones markers (insulin (INS), and glucagon (Gcg)), and, pancreatic–specified transcription factors (pancreatic and duodenal homeobox 1 (PDX-1), Neurogenin 3 (Ngn 3), forkhead box protein A2 (Foxa-2), and SRY-box transcription factor 17 (Sox-17)). SYBER Green-based qPCR reactions were implemented in a total volume of 20 µL containing 10 µM of each primer, 10µL of 2xSensiFAST SYBER Lo-ROX and 1µL of cDNA. PCR reactions were provided in duplicate and heated to 95°C for 10 min followed by 40 cycles of denaturation at 95°C for 15 seconds, annealing at 58–60°C for 1 min, and extension at 72°C for 20 seconds. 2^−ΔΔCt comparative cycle time (CT) was anticipated to define fold differences between samples and normalized to an endogenous reference (GAPDH). The primer sequence for human marker genes were as follows: Foxa-2, F;5’- GGAGCGGTGAAGATGGAAGG-3’, and R; 5’-CGGCGTTCATGTTGCTCAC-3’, sox-17, F; 5’-CAAGATGCTGGGCAAGTC-3’, and R; 5’-TGGTCCTGCATGTGCTG-3’, PDX-1, F; 5’-ATGGATGAAGTCTACCAAAGC-3’, and R; 5’- CGTGAGATGTACTTGTTGAATAG-3’²⁰, Ngn3, F;5’-CGCCGGTAGAAAGGATGAC-3’ and R; 5’-GAGTTGAGGTTGTGCATTCG-3’²¹; Glucagon, F; 5’-ACCAGAAGACAGCAGAAATG − 3’, and R; 5’-GAATGTGCCCTGTGAATG − 3’, Insulin, 5’-AACCAACACCTGTGCGGCTCA-3’ and 5’-TGCCTGCGGGCTGCGTCTA-3’²⁰; and GAPDH, F; 5’-GCACCGTCAAGGCTAGAAC-3’, and R; 5’-TGGTGAAGACGCCAGTGGA-3’²².

In vitro glucose-stimulated insulin secretion (GSIS) assay

Different generated IPCs were gently washed twice with phosphate buffer saline (PBS, Biowest, France). Then, the cells were pre-incubated in culture media containing glucose (5.5 mM) at 37 °C for 24 h²³ and supernatants were then collected for insulin quantification via ELISA (Epitope Diagnostics, Inc., USA) according to the manufacturer’s instructions. Insulin levels were calculated according to the standard curve.

Labeling of the generated IPCs with PKH26 dye

The most functionally generated IPCs were harvested and labeled with PKH26 (Sigma-Aldrich, USA) fluorescent linker dye according to the manufacturer’s instructions. STZ- induced diabetic rats were infused with IPCs- labelled cells (5 × 10⁶ cells/rat). Later, experimental animals were sacrificed and pancreatic tissues were examined using fluorescence microscope (Olympus, CKX41, Japan) to detect and trace the cells.

Induction of diabetes mellitus and treatment of diabetic rats with IPCs

Animals

Adult male albino Wistar rats (n = 30) weighing 150–170 g were obtained from the Animal Care Unit of the National Research Centre, Giza, Egypt. Rats were maintained under standard complete sterile conditions in a temperature-stabilized room with a 12 h light/dark schedule, and were allowed for free nourishment. All experimental animals has been given 1-week acclimatization period before experiment. The experimental procedures were established in compliance with the Institutional Ethical Committee guidelines.

IPCs infusion

At the end of the acclimatization period, the animals were classified into 3 groups. Group 1 (n = 10), served as negative control group and received no drugs. Group 2&3 were induced to be diabetic models through single infusion of 50 mg/kg streptozotocin (STZ, Sigma, USA) following an overnight fast. Fasting blood glucose (FBG) was measured after 72 h from injection. It was considered as a state of diabetes when the blood glucose level reached 250 mg/dl. Group 2 (n = 10), was left untreated (DM untreated), while in Group 3 (n = 10), 5 × 10⁶ cells/rat of IPCs produced by selected protocol were infused via tail veins (DM + IPCs). Four weeks after infusion, IPCs therapeutic efficacy was evaluated²⁴.

Functional analysis of infused IPCs

According to the manufacturer’s guidelines, blood glucose level (Chemelex S.A., Spain) was estimated. Serum insulin (INS), c-peptide (CP) and visfatin levels as well as pancreatic glucagon (GC) level were also quantified by ELISA kits (SinGeneClon Biotech Co., Ltd, China).

Molecular genetic analysis

Total RNA was isolated from pancreatic tissue of rats of different experimental groups using trizol reagent (Invitrogen, USA.) in combination with RNeasy mini kit for total RNA purification from animal cells (Qiagen, Germany) according to the manufacturer’s instruction. RNA integrity was evaluated using Nano Drop 2000 (Thermo Fisher Scientific, Rockford, IL, USA) using 260/280 nm ratio. Then, cDNA synthesis was performed using Revert Aid first strand cDNA synthesis kit (Thermo Fisher Scientific, Inc., Lithuania) according to the manufacturer’s instruction. Gene expression analysis of Foxa2 and Sox17, insulin-like growth factor I (IGF-1) and fibroblast growth factor (FGF) 10 was carried out in rat pancreatic tissues using DNA-Technology Real-Time PCR device (DT lite 4, Russia). The reaction mixture (25 µl volume) included 12.5 µl of QuantiTect SYBR Green master mix (Qiagen), 0.75 µl of forward and reverse primer of target gene (Invitrogen), cDNA template (100 ng) and RNase free water. GAPDH was used as a housekeeping gene. The primer sequence for rat gene markers were as follows: Foxa-2, F; 5’-TGAAGCCCGAGCACCATTAC-3’, and R; 5’-CCAGGGTAGTGCATGACCTGTT-3’²⁵; Sox-17, F; 5’- GGCGCCAGCCGGGACCTC-3’, and R; 5’- GGCCGCCCTCGGGACCAA − 3’¹⁸, IGF-1; F; 5’-GCTTTTACTTTCAACAAGCCCACA-3’, and R; 5’- TCAGCGGAGCACAGTACATC − 3’, FGF-10; F; 5’- TTGCTCTTCTTGGTGTCTTCC − 3’, and R; 5’- ACCTTGCCGTTCTTTTCAATC − 3’²⁶, GAPDH, F; 5’- CACCCTGTTGCTAGCCATATTC-3’, and R; 5’- GACATCAAGAAGGTGGTGAAGCAG − 3’²⁷. Relative mRNA expression versus control value was assessed using the 2^-ΔΔCt comparative method after normalization with GAPDH gene. The PCR cycling was set as follows: initial denaturation step at 94ºC for 15 min, followed by 40 cycles of denaturation at 94 °C for 15 s, annealing at 60 °C for 30 s and extension at 72 °C for 30 s for 5 min. Data were presented as the fold change in gene expression level in the diabetic group relative to the control group. While, data were represented as the fold change in gene expression as compared to diabetic group in case of treated group.

Histological inquiry of pancreas tissue

Pancreas tissues were fixed in 10% formalin overnight, and then embedded in paraffin wax. 5–6 microns’ thickness- tissue blocks were provided to be stained with Hematoxylin and Eosin stain (H&E) for further histological examination according to standard protocols²⁸. The morphological structure of each tissue sample was demonstrated under a light microscope (Olympus, Japan).

Statistics

Statistical parameter’s estimation was provided as arithmetic means with their standard deviations (S.D). Statistical significance among groups was analyzed by one-way analysis of variance (ANOVA) test using the Statistical Package for the Social Sciences (SPSS) 20 followed by defining the least significant difference (LSD). A value of P < 0.05 was rated to elucidate statistical significance.

• SEO Powered Content & PR Distribution. Get Amplified Today.
• PlatoData.Network Vertical Generative Ai. Empower Yourself. Access Here.
• PlatoAiStream. Web3 Intelligence. Knowledge Amplified. Access Here.
• PlatoESG. Carbon, CleanTech, Energy, Environment, Solar, Waste Management. Access Here.
• PlatoHealth. Biotech and Clinical Trials Intelligence. Access Here.
• Source: https://www.nature.com/articles/s41598-024-74527-w