A retinoid analogue, TTNPB, promotes clonal expansion of human pluripotent stem cells by upregulating CLDN2 and HoxA1 – Communications Biology

Culture and maintenance of hPSCs

The hESC line H9 was obtained from WiCell Research Institute, USA and the hiPSC lines 4YF was obtained from Dr. James Ellis’ laboratory at the University of Toronto (Toronto, Canada). Both hESCs and hiPSCs were routinely cultured and maintained in chemically defined, feeder-free Laminin-511™ (Nacalai) with mTeSR™1 medium (STEMCELL Technologies) under standard culture conditions (37 °C, 5% CO₂). We coated 60 mm culture dishes with Laminin-511™ prior to cell culture for at least 2 h at room temperature. Cells were grown on ECM-coated dishes containing complete mTeSR™1 medium. Cells were passaged on every 4–5 days as single cells via enzymatic treatment. Briefly, the spent medium was aspirated and cells were washed once with DPBS -/- (Gibco), and then treated with TrypLE Express (Gibco) with 0.5 mM EDTA (Invitrogen) and 10 µM ROCK inhibitor, Y-27632 (STEMCELL Technologies). After incubating the cells for 5–7 min at 37 °C, mTeSR1 was added and cells were detached from the plate by pipetting. After centrifugation, cells were resuspended in fresh mTeSR™1 medium and counted by automatic cell counter (Thermofisher), and seeded onto Laminin-511-coated plates at 1 × 10⁴ cells/cm² in mTeSR™1 medium. On the next day, medium was replaced with fresh medium without Y-27632 and maintained until the next passage.

Cell seeding at clonal density

Human PSCs were dissociated into single cells, and then seeded onto 35 mm culture dishes coated either with Laminin-511 or Matrigel. Cells were seeded at a density of 50–100 cells/cm² after counting with an automatic cell counter for the clonal expansion. Two mL of mTeSR™1 medium was added with 10 µM ROCK inhibitor and 0.5 µM TTNPB (Tocris Biosciences). Two to three days after seeding, the spent medium was replaced with fresh mTeSR™1 medium without the two chemicals. Then the media were changed every other day thereafter. Colonies were counted on day 7. Then colony forming efficiency was calculated by dividing the total number of colonies with the total number of seeding cells.

Seeding GFP-labeled cells mixed with unlabeled cells

To determine whether hPSC colonies were clonally expanded from a single progenitor, hESCs were labeled by transient transfection via nucleofection (Amaxa) using the reporter plasmids gWiz-GFP (Genlantis), which expresses the green fluorescent protein (GFP) reporter. Following nucleofection, cells were re-plated at a density of 5 × 10⁵ cells/cm². One day after nucleofection, cells were dissociated into single-cell suspension and FACS sorted (Sony) to enrich GFP-positive cells to 98% purity. Afterwards, transfected GFP⁺ cells were mixed with non-transfected unlabeled cells at a ratio of 1:1, then seeded onto 35 mm dishes at a density of 50 GFP-labeled and 50 unlabeled cells/cm². Colony formation was monitored daily thereafter up to day 4, when GFP fluorescence level dropped below the detectable range. Brightfield and GFP expressing images were captured every day to detect the clonal expansion of hPSC using a confocal microscopy (Olympus).

Adherent and suspension culture of hPSCs

Human PSCs were dissociated into single cells using TrypLE Express with 0.5 mM EDTA and 10 µM Y-27632. Then cells were counted using an automatic cell counter. For the expansion of cells in adherent culture with passaging density, single cells at a density of 1 × 10⁴ cells/cm² were seeded with mTeSR™1 medium in a 6-well plate coated with Laminin™ with Y-27632, TTNPB or Y-27632 + TTNPB, and then incubated at standard culture conditions (37 °C, 5% CO₂). The spent medium was changed every day from day 2 without the two chemicals and cultured until day 4. Cells were dissociated into single cells using TrypLE Express with 0.5 mM EDTA and 10 µM Y-27632 on day 1 to determine adhesion ratio. Cells were counted using an automatic cell counter. Cell adhesion/survival ratio was calculated by dividing total cell number on day 1 with the total number of seeded cells on day 0. Final number of cells was determined by counting the total number of cells on day 4.

For the optimizing the different concentrations of TTNPB, single cells (2 × 10⁵ cells/ml) were seeded in ultra-low attachment 6-well plate (Corning) with 0.25, 0.5, 0.63, and 0.75 µM of TTNPB and cultured for 5 days. The morphology of the aggregates were observed everyday under a brightfield microscope (Olympus). For the expansion of cells in suspension culture, single cells at a density of 2 × 10⁵ cells/ml were seeded with mTeSR1 medium in an ultra-low attachment 6-well plate with Y-27632, TTNPB or Y-27632 + TTNPB, and then incubated at standard culture conditions (37 °C, 5% CO₂). Two days after seeding, the spent medium was replaced with fresh mTeSR1 medium without the two chemicals. Then the media was changed every day thereafter. Aggregates were dissociated into single cells using TrypLE Express with 0.5 mM EDTA and 10 µM Y-27632 on day 1 to determine the survival ratio. Cells were counted using an automatic cell counter. Cell survival ratio was calculated by dividing total cell number on day 1 with the total number of seeded cells on day 0. Final number of cells was determined by counting the total number of cells on day 5.

Immunofluorescent staining

Cell colonies were fixed with 4% paraformaldehyde (PFA) for 15 min at room temperature, washed three times with 1x phosphate buffered saline (PBS), permeabilized with 0.1% Triton-X 100 (Sigma Aldrich) for 15 min at room temperature, and then washed three times with PBS. Cells were blocked with 10% fetal bovine serum (FBS) for 30 min at room temperature to minimize non-specific binding of antibodies. Fixed hPSC colonies were incubated with primary antibodies against Oct4 (Milipore), Nanog (Milipore), SSEA-4 (Milipore), TRA-1-60 (Milipore), and YAP (Cell Signaling) at 1:100 dilution and kept at 4 °C overnight. Differentiated embryoid bodies (EBs) were incubated with primary antibodies (all from Sigma-Aldrich) against ®-tubulin III (ectoderm marker), smooth muscle actin (mesoderm marker), and α-fetoprotein (endoderm marker) at 1:400 dilution and kept at 4 °C overnight. The next day, cells were washed and incubated with the secondary antibodies, Alexa Fluor 488, 546 and 594 (1:200; Invitrogen) for at least one hour at room temperature. Cells were then washed 3 times with PBS before adding DAPI in Slowfade. For monitoring F-actin and myosin, cells were stained with Phalloidin (Invitrogen) and anti-non-muscle Myosin IIA antibody (Abcam), respectively. Then the cells were incubated with Slowfade containing DAPI before imaging with confocal microscopy (Nikon).

Flow cytometry

Pluripotency markers, Oct4, Nanog, SSEA4 and Tra-1-60, were analyzed by fluorescence-activated cell sorting (FACS). Briefly, cell colonies were dissociated into single cells using TrypLE Express, were fixed with 4% PFA, washed three times with PBS, and permeabilized with 0.6% Saponin (Sigma Aldrich). After three washes with PBS, cells were then resuspended in PBS containing 3% BSA for 30 min at 37 °C. Resuspended cells were incubated with the following antibodies (Millipore) for at least 1 h at 37 °C: anti-Oct4 (Alexa Fluor 488 conjugate; 1:50 dilution, Millipore), anti-Nanog (FITC conjugate; 1:50 dilution, Millipore), anti-SSEA-4 (PE conjugate, 1:50 dilution, STEMCELL Technologies) and anti-Tra-1-60 (PE conjugate, 1:50 dilution, STEMCELL Technologies). Mouse IgG Alexa Fluor 488, mouse IgG1 FITC, mouse IgG3PE and mouse IgM PE, kappa were used as isotype controls for the primary antibodies. Flow cytometric analysis was performed using FACSAria III (BD Biosciences).

In vitro differentiation

Cell colonies were dissociated and plated onto 35 mm agar-coated dishes (low attachment) in a differentiation medium consisting of DMEM supplemented with 15% fetal bovine serum (FBS), 1mM L-GlutaMax, 0.1 mM 2-mercaptoethanol, and 1 mM nonessential amino acids (all reagents were from Life Technologies). Five to seven days later, when some of the aggregates formed cystic embryoid bodies (EBs), they were collected, re-plated onto gelatin-treated four-well plates in the same medium and cultured for 6–10 days. Then the EBs were fixed, and immunocytochemical staining was performed on early differentiation markers of the three germ layers as stated above.

In vivo differentiation

In vivo differentiation was performed by teratoma assay. Cell colonies were dissociated into single cells, then collected by centrifugation and injected into the rear leg muscles of 6- to 8-week-old SCID-beige mice (2 × 10⁶ cells per injection). Teratomas were removed from injection sites after 10–12 weeks, fixed overnight in 4% PFA. The samples were then embedded in paraffin, sectioned, and examined histologically after staining with Eosin and Haematoxylin for the three germ layers.

RNA sequencing

Confluent ESCs were dissociated into single cells using TrypLE Express and seeded in a 6-well plate in passaging density with or without TTNPB as described above. On the next day, RNA extraction was performed after treatment with Trizol (Sigma). At least triplicate samples were harvested for preparing RNAs. Then RNA sequencing libraries were prepared from purified RNA using NEBNext Ultra™ Directional RNA Library Prep Kit (New England Biolabs) for Illumina sequencing according to the manufacturer’s instructions. The individual libraries were sequenced by NextSeq 500 (Illumina). Base-scaling and demultiplexing were done with bcl2fastq v.2.17.1.14 software (Illumina). The RNA-seq data were analyzed by Ingenuity Pathway Analysis software (Qiagen).

Generation of CLDN2 and HoxA1 knockout cells, DNA sequencing and PCR Surveyor assay

The CLDN2 and HoxA1 knockout cell lines were developed using CRISPR/Cas9 technology. Three human CLDN2 and HoxA1 short gRNA targets on Exon 1 were designed, synthesized, ligated into pX458 vector- pSpCas9(BB)-2A-GFP (Addgene) and confirmed by DNA sequencing. Oligo synthesis and DNA sequencing were done at the DNA Laboratory in the University of Calgary. The gRNA sequences for CLDN2 are: (i) CTAGGATGTAGCCCACAAGT (ii) GGTGCTATAGATGTCACACT and (iii) ACGGGACTTCTACTCACCAC. The gRNA sequences for HoxA1 are: (i) GCTTGGACCACAACTTGAGT (ii) CATTCACCACTCATATGGAC, and (iii) GAGTCGCCACTGCTAAGTAT. Then the CRISPR activity of both gRNAs were tested. From 3 gRNAs tested, gRNAs (ii) and (iii) were selected for transfection of H9 cells for CLDN2 knockout. For the HoxA1 knockout, gRNAs (i) and (ii) were used for generation of HoxA1 knockout. After transfection of the CRISPR constructs, GFP positive cells were sorted into 96-well plates by Flow Cytometry. Two knockout clones for both CLDN2 and HoxA1 were isolated and examined. Cells were expanded, and DNA sequencing was performed thereafter for confirming the disruption of CLDN2 and HoxA1.

For PCR Surveyor assay, DNA fragments around short guide DNA sites were amplified by PCR. G and C DNA fragments were also amplified as positive control. All DNA samples were cleaved with Surveyor nuclease according to Manufacturer’s recommendations (Integrated DNA Technologies) and then analyzed on 10% TBE acrylamide gel.

For DNA sequencing, DNA fragments around the short gRNA site of CLDN2 and HoxA1 knockout clones were amplified by PCR. Then the PCR products were subcloned into pEGFP-C2 vector (Clonetech). After that, the plasmid DNA from individual clones were sent for Sanger DNA sequencing at the DNA laboratory, University of Calgary to confirm all indels. The DNA sequencing data were analyzed by Chromatography software.

Culture of CLDN2 and HoxA1 knockout cells

The CLDN2 and HoxA1 knockout cells were cultured on Laminin-511™ -coated 6-well plates with mTeSR™1 medium. When confluent, cells were dissociated into single cells and then counted using an automatic cell counter. Then single cells at a density of 1 × 10⁴ cells/cm² were seeded with mTeSR™1 medium in a 6-well plate coated with Laminin™ with either Y-27632 or TTNPB, and then incubated at standard culture conditions. Cells were observed under a brightfield microscope and counted on day 1 and 3 after dissociating into single cells.

Cell adhesion assay

Cell adhesion assays were done using a protocol described elsewhere³¹. In brief, hPSCs were treated with TTNPB (0.25-0.5 μM) in the presence or absence of Y-27632. Twenty-four hours after, cells were dissociated using TrypLE Express, collected and counted. A total of 5 × 10⁴ cells were seeded into each well of a 96-well plate coated with the Laminin and incubated for 6 h. Then, cells were washed two times with DMEM/F12 to remove non-adherent cells. Adherent cells were fixed with 10% formalin for 15 min, and post-fixed in 100% ethanol for 5 min at room temperature. Following fixation, cells were then stained with 0.4% crystal violet in methanol for 5 min at room temperature. Cells were then rinsed with demineralized water followed by solubilizing by adding 1% SDS, and the optical density at 570 nm was measured by a microplate reader (Bio-Rad).

Western blot

For analysis of western blots, the cells were lysed with Radio Immunoprecipitation Assay (RIPA) Buffer. The lysates were sonicated twice for eight seconds and centrifuged to remove any remaining cell pellet. The Halt™ Protease Inhibitor Cocktail (Thermo Fisher Scientific) was added to each sample (1:1000) to prevent protein degradation. Bradford’s method was employed to assess total protein content. 30 μg of total protein from each sample was separated using 12% SDS-PAGE followed by electro-transferred onto a nitrocellulose membrane. The membrane was incubated with blocking buffer containing 5% skim milk powder overnight at 4 °C. Then, the membranes were probed with specific antibodies against cleaved‑caspase3 (1:500; Invitrogen) and β-actin (1:200 dilution; Santa Cruz) for 1.5 h at room temperature. Finally, the membrane was incubated with specific secondary antibodies for 1 h. After washing with TBST buffer three times, quantification of the results was performed by a densitometric scan of films. For analysis we employed Image J software, measuring the integrated density of bands after background subtraction.

Quantitative real time PCR

RT-qPCR was used to determine the relative gene expression of E-cadherin, Bcl-2, YAP, Ki-67 and Cyclin-D1 in Y-27632- and TTNPB-treated cells. First, total RNA was extracted using the Single Cell RNA Purification Kit (Norgen Biotek Corp.) according to the manufacturer’s instructions. RNA concentrations were then determined by spectrophotometer. The RNA was transcribed into cDNA using the protoscript II c-DNA synthesis kit (New England Biolabs). cDNA generation consisted of the following steps: 65 °C for 5 min, 42 °C for 60 min, and 80 °C for 5 min. Finally, fast SYBR™ Green Master Mix (Thermo Fisher Scientific) was used for the RT-qPCR gene expression analysis (performed on the Applied Biosystems™ StepOnePlus™ Real-Time PCR System). The mRNA expression levels were all quantified relative to the housekeeping gene, GAPDH.

RNA isolation and RT-PCR

hESCs were cultured on a plate with Y-27632 and TTNPB. Then single cells were collected for RNA isolation on day 3. Total RNA was extracted using RNeasy Mini kit (Qiagen) according to the manufacturer’s instructions with DNase I digestion. RNA was measured using a NanoPhotometer P-Class (IMPLEN), and then 500 ng RNA were used for cDNA synthesis using Superscript® IV Reverse Transcriptase (Thermo Fisher Scientific) and Oligo(dT)20 Primer (50 µM) (Thermo Fisher Scientific) according to the manufacturers’ instructions. GAPDH was used as a housekeeping gene. Primer sequences used in the amplification reactions are HOXA1 (sense) GGGAAAGTTGGAGAGTACGGC; HOXA1 (antisense) CCTCAGTGGGAGGTAGTCAG; CLDN2 (sense) TCCGTCTGTCTGTCTGTGTG; CLDN2 (antisense) ATTGATCACCTTGTGTGTGC; GAPDH (sense) ACAGTCAGCCGCATCTTCTT; GAPDH (anti-sense) GACAAGCTTCCCGTTCTCAG. The PCR products were separated on 1% agarose, stained with ethidium bromide, and then visualized and photographed on a UV transilluminator.

Statistics and reproducibility

All experiments were performed at least triplicate and data represented as mean ± SD. Exact N values for each experiment are defined and described in the figure legends. We used Student’s T test for evaluating the significance from three replicate experiments. P < 0.05, P < 0.001 and P < 0.0001 were considered as significant.

Reporting summary

Further information on research design is available in the Nature Portfolio Reporting Summary linked to this article.

• SEO Powered Content & PR Distribution. Get Amplified Today.
• PlatoData.Network Vertical Generative Ai. Empower Yourself. Access Here.
• PlatoAiStream. Web3 Intelligence. Knowledge Amplified. Access Here.
• PlatoESG. Carbon, CleanTech, Energy, Environment, Solar, Waste Management. Access Here.
• PlatoHealth. Biotech and Clinical Trials Intelligence. Access Here.
• Source: https://www.nature.com/articles/s42003-024-05812-7