A humanized mouse model for adeno-associated viral gene therapy – Nature Communications

Mouse maintenance, experiments, and euthanasia

All aminals were maintained under a standard 12-h dark/light cycle with water and chow (Picolab Rodent diet 20, LabDiet, cat# 5053) provided ad libitum. All animal experiments were approved by the Duke University Institutional Animal Care and Use Committee. Euthanasia was done via carbon dioxide overdose followed by decapitation or bilateral opening of the thoracic cavity to ensure immediate death.

Generation of TIRFA mice by CRISPR/Cas9 gene editing in zygotes

Design and cloning of sgRNA was done as previously described²⁵. In brief, complementary oligonucleotides were cloned into the DR274 vector (Addgene, cat# 42250).

We targeted exons 4 and 5 of the mouse Aavr gene (Fig. 1a) using the following sgRNAs:

Aavr-sgRNA Ex4: 5′ ACTTGCGGAGTACCAGATACAGG 3′

Aavr-sgRNA Ex5: 5′ CATTCTTAGGCAGGGTGATCTGG 3′

A T7 bacterial promoter sequence was inserted into the pX330-U6-Chimeric_BBCBh-hSpCas9 vector (Addgene plasmid # 42230) upstream of the Cas9 transcription start site. DR274 vectors were cut using DraI (NEB) and pXX30–spCas9 was digested with NcoI and NotI. Vectors were gel purified using the Zymoclean Gel DNA Recovery Kit (Zymo, Cat#11–301).

sgRNAs and Cas9 were in vitro transcribed in vitro using MEGAshortscript T7 Transcription Kit (Life Tech, AM1354) and mMessage mMachine T7 ULTRA Kit (Life Tech AM1345), respectively. The resulting RNAs were purified using RNA Clean & Concentrate columns (Zymogen, cat# R1015) and eluted in RNAse-free water, and synthesis was verified by polyacrylamide gel electrophoresis.

A mix of 15 ng/ μL of each sgRNA and 60 ng/μL of Cas9 mRNA in PBS was used for the zygote’s microinjection. SpCas9 and sgRNA were injected into homozygous zygotes from TIRF (Transgene free Il2rg^−/−/Rag2^−/−/Fah^−/−) mice.

We obtained nineteen founder pups, four of which died after birth. All of them were screened for deletions. Two of the dead pups were wild-type, and the other two were homozygous. Seven out of the fifteen pups that survived were heterozygotes for an Aavr deletion. We obtained a total of four deletions, some of them shared by more than one mouse, and all of them led to a premature stop codon after the junction site. Mice with confirmed deletion of Aavr gene were backcrossed twice with the TIRF strain to eliminate any possible off-target mutations. Heterozygote F2 mice were crossed with each other to obtain homozygote pups. As previously described, homozygous males could not breed²⁶. To generate homozygous animals used in this paper, we crossed heterozygous males with homozygous females.

Genotyping of the TIRFA strain

All of the pups obtained were screened by PCR using the following primers:

Aavr_Ex4 For: 5′-ACAGTTGCCGGTTCCTTCAC-3’

Aavr_In5 Rev: 5′-CCACATGCACATCACAACCTC-3′

The expected PCR bands for wild-type and knocked-out mice were 2.3 Kb and 250 bp, respectively. PCR bands corresponding to deleted alleles were purified and sent for Sanger sequencing. Once the junction was defined, the further offspring were genotyped by Transnetyx Incorporation.

Human hepatocyte isolation

We isolated human hepatocytes by the two-step collagenase perfusion method as we described previously¹². In brief, we cannulated the largest portal veins with a silicon tubing system connected to a peristaltic pump, then flushed the liver with ice-cold basic perfusion solution (BPS: 10 mM Hepes buffer) followed by perfusion with BPS containing 0.5 mM EGTA to prevent the formation of blood clots. The liver was then perfused with warm collagenase solutions (2 mg/dl collagenase) until the organ became soft. We cut the liver into small pieces (2–3 cm³) and released hepatocytes into the solution by applying minor shear stress (with forceps) on the pieces. Hepatocytes were immediately washed in ice-cold BPS containing 0.5% BSA, centrifuged (3 times 50×g, 5 min), and cryopreserved in NG5A (ChemQ Bioscience.). The IRB of Baylor College of Medicine and/or Duke approved the procurement of human tissue. Informed consent was obtained where “human subject research” was determined.

Transplantation of human hepatocytes into TIRF-AAVR-KO strain

Cryopreserved hepatocytes were transplanted into 8-week-old TIRFA mice as previously described^12,16,17. In brief, the abdominal cavity was opened by a midabdominal incision, and 3×10⁶ human hepatocytes in a volume of 100 μl PBS were injected into the spleen. Immediately after transplantation, selection pressure towards transplanted human hepatocytes was applied by withdrawing the drug NTBC from the drinking water in the following steps: 2 days at 25%, then 2 days at 12%, and eventually 2 days at 6% of the colony maintenance dose (100% = 7.5 mg/l) prior to discontinuing the drug completely¹⁰. In order to determine the extent of human chimerism, we measured human albumin (ELISA, Bethyl laboratories) in the murine blood.

Both female and male animals were used for humanization.

AAV production

A triple-plasmid transfection protocol was used to generate rAAV vectors²⁷; the transfection mixture contained: (1) the pXR helper plasmid; (2) the adenoviral helper plasmid pXX6–80; and (3) the tandem dimer Tomato (tdTomato), driven by a CBA promoter, flanked by AAV2 ITRs or GFP driven by the CBA promoter. Vector purification was carried out using iodixanol gradient ultracentrifugation followed by desalting with ZebaSpin desalting columns (40 K MWCO; ThermoScientific, Waltham, MA, USA). vg titers were obtained by qPCR (LightCycler 480; Roche Applied Sciences, Pleasanton, CA, USA) using primers designed to selectively bind AAV2 ITRs:

For: 5′-AACATGCTACGCAGAGAGGGAGTGG-3′

Rev: 5′-CATGAGACAAGGAACCCCTAGTGATGGAG-3′

Determination of vector genome biodistribution by quantitative PCR

DNA was extracted from tissue using a Purelink Genomic DNA Mini kit (Thermo Fisher Scientific) following manufactures instructions. Vector genomes were quantified via qPCR, using a plasmid standard and primers targeting the SV40 polyA in the AAV genome. LightCycler 480 SYBR Green I Master Mix (Roche) was used following manufacturer instructions for cycling conditions. The biodistribution of viral genomes is calculated as the ratio of vector genomes per microgram of DNA extracted and represented as fold change relative to mock.

Primers:

SV40_For: 5′-GCAGACATGATAAGATACATTGATGAGTT-3′

SV40_Rev: 5′-AGCAATAGCATCACAAATTTCACAA-3′

Generation of teratoma and liver cancer xenograft models

Human induced pluripotent stem cells (iPSC) were cultured on matrigel (Corning) and in mTeSR media (Stemcell Technologies). In total, 2–5 million iPSC were scraped from culture plates and injected in 100 μl mTeSR subcutaneously to TIRFA mice. Over 3–4 months, human teratomas developed. Mice were injected with AAV (1 × 10¹² gc/mouse, i.v.) when teratomas were visible and reached 1 cm diameter.

Cryopreserved pieces of pediatric liver cancer (hepatoblastoma) were implanted onto the liver as previously described. In brief, the abdominal cavity of TIRFA mice was incised, and ~50 mm³ pieces were glued (Vetbond tissue adhesive, TM) onto the left lower liver lobe. The IRB of Baylor College of Medicine and Duke University Medical Center approved the procurement of human tissue. Informed consent was obtained from patients.

Immunostaining chimeric livers and teratomas

Immunostaining was performed on formalin-fixed paraffin-embedded samples. Paraffin sections (5 μm thick) were dewaxed and rehydrated. For immunohistochemistry (IHC), all the samples were treated with hydrogen peroxide and blocked using corresponding blocking serum as recommended by the manufacturer’s instructions.

Rabbit anti-hFAH primary antibody (Sigma Aldrich, cat# SAB2108553) was diluted 1:250 and incubated overnight at 4 °C. IHC was developed following the rabbit kit (Vector Labs, cat# PK4001) manufacturer’s instructions.

Co-staining of tdTomato (red for IF, brown for IHC) and hLDH (green for IF, magenta for IHC) required antigen retrieval with citrate buffer pH 6.0 for 30 min. After blocking with 2.5% horse serum, samples were incubated overnight at 4 °C with mouse monoclonal anti-hLDH antibody (Santa Cruz cat# LDH (H-10) sc-133123) in combination with rabbit anti-RFP antibody (Rockland, cat# 600–401–379), both diluted 1:100 in antibody diluent (Abcam, cat# ab642111) at 4 °C. Immunofluorescence (IF) was developed using fluorescent-labeled secondary antibodies (Jackson ImmunoResearch Laboratories) and IHC was developed following Vector ImmPRESS Duet immunohistochemistry kit manufacturer’s instructions (Vector Labs, cat# MP-7714–15).

Co-staining of GFP (brown color) and LDH (magenta color) was performed in two steps. First, GFP immunostaining was performed by incubating the samples overnight at 4 °C with chicken anti-GFP (Abcam cat# ab13970) diluted 1:1,500 in antibody diluent. After washing, samples were incubated with anti-chicken biotinylated secondary antibody (Vector Labs, BA-9010) diluted 1:200 for 30 min, and the signal was developed using avidin/biotin/DAB system (Vector Labs, cat#PK4001). After developing, antigen retrieval with citrate buffer pH 6.0 for 30 min was performed, and samples were incubated overnight at 4 °C with anti-LDH antibody diluted 1:100. Magenta color was developed using Vector ImmPRESS Duet kit (Vector Labs, cat# MP-7714-15).

Immunofluorescence of teratoma samples was performed co-incubating overnight at 4 °C with chicken anti-GFP (Abcam cat# ab13970) diluted 1:200, in combination with the corresponding primary antibody diluted in abcam antibody diluent. The following antibodies required 15 min of antigen retrieval in citrate buffer pH 6.0: Rabbit anti-Sox17 (Millipore, cat# 09-038-1) diluted 1:150, rabbit anti-Snail (Abcam, cat# ab17732) diluted 1:500, mouse anti-LDH (Santa Cruz, cat# sc-133123) diluted 1:100 and anti-Rabbit Cytokeratin 14 (Abcam, cat# ab51054) diluted 1:1000. Rabbit anti-Cytokeratin 19 (Abcam, cat# ab52625) required 15 min EDTA pH 9.0 buffer antigen retrieval (Abcam, AB93684) and was used at a dilution of 1:400. Rabbit anti-GS (Abcam, cat# ab73593) was diluted 1:500 and rabbit anti-FAS (Santa Cruz, cat# sc-715) was diluted 1:50. After washing primary antibodies, samples were incubated with corresponding Alexa-fluor fluorescent-labeled secondary antibodies (Jackson ImmunoResearch Laboratories).

Quantification of human cells transduced with tdTomato

Co-stained human cells (hLDH and RFP positive) and a total of human cells (hLDH positive only) from 5 different lobes were quantified using ImageJ software (https://imagej.nih.gov/ij/).

A minimum of 2000 cells were quantified, and the results are expressed as a percentage of human cells expressing tdTomato.

In situ reverse transcriptase PCR (RT-PCR) for the detection of AAV mRNA

The protocol of in situ hybridization was modified from previous reports^28,29. Paraffin sections (5 μm) were dewaxed, and antigen retrieval was performed using 10 mM sodium citrate buffer at 100 °C for 10 min. Subsequently, slides were given a DNase treatment with 2.5 units DNase (Thermo Scientific, EN0521) for 1 hr at 37 °C. The reaction was inactivated in 5 mM EDTA for 10 min. The slides were immersed in 2× SSC (Invitrogen, AM9763) for 5 min, followed by 95% 100% ethanol for 5 min each at room temperature and air-dried. For the reverse transcription (RT) reaction, 120 μl of RT reaction solution (12 μl 10 × RT buffer, 24 μl 25 mM MgCl₂, 12 μl 10 mM dNTP, 3 μl RNase Out, 6 μl Reverse transcriptase, 6 μl 100 nM reverse primer, 57 μl DEPC treated water) was added to each slide. The RT cycle ran at 30 °C for 10 min, 42 °C for 30 min, and 90 °C for 5 min. Slides were then immersed in 2xSSC for 5 min, followed by 95% and 100% ethanol for 5 min each at room temperature. For the mRNA amplification, primers designed to selectively bind tdTomato were used. 120 μl of the amplification reaction solution (60 μl Taq Master Mix (Apex Bioresearch, 42–138), 2 μl 1 mM Digoxigenin-11-dUTP (Roche, cat# 11093088910), 6 μl 1 mM forward and reverse primer, 57 μl water) was added, and 5 amplification cycles were run at 95 °C for 30 min, 58 °C for 30 min, and 72 °C for 1 min.

Slides were immersed in 2 × SSC at room temperature for 30 min. For detection of the signal, sections were incubated in buffer 1 (150 mM Tris, 100 mM/NaCl, pH 7.5) for 30 min and followed by a 2 h incubation with a 1:5000 diluted AP-coupled anti-DIG antibody (Roche, cat # 11093274910) in buffer 2 (0.5% Boehringer blocking reagent in buffer 1). Sections were washed in buffer 1 for 30 min and then incubated in a 1:50 diluted NBT/BCT (Roche, cat #11681451001) in buffer 3 (100 mM Tris 100 mM/NaCl, 50 mM MgCl₂, pH 7.5) for 2 h. The staining reaction was stopped with TE buffer (10 mM Tris, 1 mM EDTA, pH 8.0) for 15 min. The non-specific background was removed in 95% ethanol for 1 h, followed by rinsing in water to dissolve potential crystals. Finally, sections were stained in Nuclear Fast Red Counterstain (Vector, H-3403–500), underwent dehydration, and were mounted.

In situ PCR for the detection of AAV DNA

Paraffin sections (5 μm) were dewaxed, and antigen retrieval was performed using 10 mM sodium citrate buffer at 100 °C for 10 min. Subsequently, slides were given a 0.02 M HCl for 10 min at room temperature. Slides were immersed in 1× PBS for 5 min, followed by a 10 μg/ml proteinase K digestion for 20 min at room temperature. For the amplification step, 120 μl of the amplification reaction solution (60 μl Taq Master Mix (Apex Bioresearch, 42–138), 2 μl 1 mM Digoxigenin-11-dUTP (Roche, 11093088910), 6 μl 1 mM forward and reverse primer, 56 μl water) was added, and 20 amplification cycles were run at 95 °C for 30 min, 58 °C for 30 min, and 72 °C for 1 min. Slides were immersed the slides in 2× SSC at room temperature for 30 min. For detection of the signal, sections were incubated in buffer 1 (150 mM Tris, 100 mM/NaCl, pH 7.5) for 30 min and followed by a 2 h incubation with a 1:5000 diluted AP-coupled anti-DIG antibody (Roche, cat# 11093274910) in buffer 2 (0.5% Boehringer blocking reagent in buffer 1). Sections were washed in buffer 1 for 30 min and then incubated in a 1:50 diluted NBT/BCT (Roche, cat # 11681451001) in buffer 3 (100 mM Tris 100 mM/NaCl, 50 mM MgCl2, pH 7.5) for 2 h. The staining reaction was stopped with TE buffer (10 mM Tris, 1 mM EDTA, pH 8.0) for 15 min. The non-specific background was removed in 95% ethanol for 1 h, followed by rinsing in water to dissolve potential crystals. Finally, sections were stained in Nuclear Fast Red Counterstain (Vector, H-3403–500), underwent dehydration, and were mounted.

Primers:

tdTomato_For: 5′-ACATGGCCGTCATCAAAGA-3′

tdTomato_Rev: 5′-CTTGTACGGCCTGTCCCATGC-3′

Reporting summary

Further information on research design is available in the Nature Portfolio Reporting Summary linked to this article.

• SEO Powered Content & PR Distribution. Get Amplified Today.
• PlatoData.Network Vertical Generative Ai. Empower Yourself. Access Here.
• PlatoAiStream. Web3 Intelligence. Knowledge Amplified. Access Here.
• PlatoESG. Carbon, CleanTech, Energy, Environment, Solar, Waste Management. Access Here.
• PlatoHealth. Biotech and Clinical Trials Intelligence. Access Here.
• Source: https://www.nature.com/articles/s41467-024-46017-0