γ-Glutamyl transpeptidase-activable nanoprobe crosses the blood-brain barrier for immuno-sonodynamic therapy of glioma

Ethical statement

This research complies with all relevant ethical regulations. All surgical interventions conducted, as well as the subsequent postoperative care provided to the animals, were vetted and approved by the esteemed Institutional Animal Care and Use Committee of Sun Yat-sen University, Guangzhou, China. The assigned approval number of the ethical application of animal experiments is 20220512-00036. The experiment was designed without considering the sex of the animals, and female mice or rats were selected in this study to ensure gender uniformity. Human hepatoma tissue sections (SHXC2021YF01) and human glioma tissue microarray sections (HBraG149Su01) were obtained from Shanghai Outdo Biotech Co., Ltd. (Shanghai, China). The studies were reviewed and approved by the Ethics Committee of this company.

Materials

The sonosensitizer ILD containing T1 MR contrast agent Gd-chelated DTPA was synthesized according to our previous study²⁸. ApoE(159-167)₂ peptide with a dibenzocyclooctyne group on N-terminal (ApoE-DBCO, sequence: (LRKLRKRLL)₂C-DBCO, 95%) was obtained from Wuhan Holder Co., Ltd. (Wuhan, China). Boc-NH-(polyethylene glycol)-2000 amine (Boc-NH-PEG_2k-NH₂) and azido-(polyethylene glycol)-3400 amine (N₃-PEG_3.4k-NH₂) were purchased from GuangZhou Tanshui Technology Co., Ltd. Perfluorododecanoic acid (C₁₁F₂₃-COOH), resiquimod (R848), N, N-diethylethylenediamine (DEA), N, N-diisoprylamino ethylamine (DIP) and histamine (His) were purchased from Aladdin Industrial Corporation (Shanghai, China) and used as received. N-α, N-ε-di-Fmoc-D-lysine (Fmoc-Lys), Boc-L-glutamic acid 1-tert-butyl ester (Boc-Glu) and N-alpha-(9-fluorenylmethoxycarbonyl)-L-2-amino-butanoic acid (Fmoc-ABU-OH) were purchased from J&K Scientific Ltd. (Beijing, China). The dialysis bag was purchased from Green Bird Technology Development Co., Ltd. (Shanghai, China). Na₂CO₃ solid, anhydrous MgSO₄ solid, NaCl solid, and diethyl ether were purchased from Chemical Reagent Factory (Guangzhou, China). Petroleum ether, ethyl acetate, chloroform (CHCl₃), and dichloromethane (CH₂Cl₂) were dried over CaH₂ and distilled. Anhydrous dimethylsulfoxide (DMSO), anhydrous dimethylformamide (DMF), perfluoropentane (PFP), and 1,1,1,3,3-pentafluorobutane (PFB) were purchased from Sigma-Aldrich (Prague, Czech Republic).

Roswell Park Memorial Institute (RPMI) 1640 Medium, Dulbecco’s Modified Eagle Medium (DMEM), penicillin/streptomycin (100X), and fetal bovine serum (FBS) were purchased from the reputable Thermo Fisher Scientific. 4’,6-diamidino-2-phenylindole (DAPI), ROS probe 2’,7’-dichlorofluorescin diacetate (DCFH-DA) and mitochondrial membrane potential probe (5,5′,6,6′-tetrachloro-1,1′,3,3′-tetraethyl-imidacarbocyanine iodide, JC-1) were purchased from Beyotime (China). Live-Dead Cell Staining Kit was purchased from KeyGEN BioTECH (China). The mouse ELISA kits for ATP, HMGB1, IL-12, IFN-β, IFN-γ, CXCL-9, and CXCL-10 measurements were purchased from Shanghai Westang Bio-Tech Co., LTD (Shanghai, China). The mouse anti-GAPDH antibody (ab8245, 6C5, GR3275542-1), mouse anti-GGT antibody (ab55138, 1F9, GR1017756-3), rabbit anti-Calreticulin antibody (ab2907, GR3426057-2), rat anti-CD8 antibody (ab25478, 53-6.7, GR3181210-4), goat anti-rabbit IgG H&L (HRP) (ab6721), goat anti-rabbit IgG H&L (Alexa Fluor® 488) (ab150077), and goat anti-rabbit IgG H&L (Alexa Fluor® 555) (ab150078) were purchased from Abcam (Shanghai, China). The rabbit anti-Iba1 antibody (GB153502, AC221117065), rabbit anti-GFAP antibody (GB15100, AC231115002), rabbit anti-CD31 antibody (GB11063, AC230814049), rabbit anti-GGT antibody (GB113421, AC231008052), and rabbit anti-LDLR antibody (GB11369, AC231017018) were provided by Wuhan Servicebio Technology Co., LTD (Wuhan, China). The armenian hamster FITC anti-CD11c antibody (117306, N418, B356966), armenian hamster PE anti-CD80 antibody (104707, 16-10A1, B340153), rat APC anti-CD86 antibody (105011, GL-1, B323580), rat BV421 anti-CD45 antibody (103134, 30-F11, B370002), rat APC anti-CD3 antibody (100236, 17A2, B375907), rat FITC anti-CD4 antibody (100406, GK1.5, B374032), rat PerCP anti-CD8 alpha antibody (100732, 53-6.7, B386876), rat PE anti-CD62L antibody (104407, MEL-14, B242685), rat FITC anti-CD44 antibody (103006, IM7, B323775), Zombie Yellow™ (423103, B330652), rat BV510 anti-CD45 antibody (103138, 30-F11, B402130), rat APC/Cyanine7 anti-CD11b antibody (101225, M1/70, B397990), rat BV421 anti-F4/80 antibody (123137, BM8, B416422), rat PE anti-Ly-6G antibody (127607, 1A8, B397726), armenian hamster FITC anti-CD80 antibody (104705, 16-10A1, B354433), rat PE/Cyanine7 anti-CD206 antibody (141719, C068C2, B399589), and rat anti-CD16/32 antibody (101302, 93, B269215) were purchased from Biolegend Company (Beijing, China). The rat PE anti-Foxp3 antibody (12-5773-82, FGK-16s, 2510310) was purchased from Invitrogen, Fisher Scientific (Shanghai, China). All additional reagents employed in this study were sourced from commercial vendors and conformed to analytical purity standards or exceeded them.

Synthesis of BEAGA₂-PEG_2k-PDHD

Synthesis of Boc-NH-PEG_2k-PBLA₈₅

As outlined in Supplementary Fig. 1, the diblock copolymer Boc-NH-PEG_2k-PBLA₈₅ was synthesized by ring-opening polymerization of β-benzyl L-aspartate (BLA-NCA) using Boc-NH-PEG_2k-NH₂ as a macroinitiator according to a previous study⁴⁶.

Concisely stated, 1.00 g of Boc-NH-PEG_2k-NH₂ (0.50 mmol) was subjected to vacuum drying for 1 h at 70 °C within a 250 mL Schlenk flask, which was equipped with a magnetic stirrer. Once the temperature had safely decreased to 35 °C, 100 mL of anhydrous CH₂Cl₂ and a solution of 10.60 g of BLA-NCA (42.50 mmol) dissolved in 10 mL of anhydrous DMF were carefully introduced into the reaction system under an inert argon atmosphere. The reaction was allowed to proceed at a controlled temperature of 35 °C for 48 h. Subsequently, the reaction mixture was precipitated into a copious amount of chilled diethyl ether, filtered to separate the solid product, washed thoroughly with diethyl ether three consecutive times, and finally dried under vacuum until a constant weight was achieved (8.74 g, 0.45 mmol, 90% yield).

Synthesis of Boc-NH-PEG_2k-PBLA₈₅-C₁₁F₂₃

Boc-NH-PEG_2k-PBLA₈₅-C₁₁F₂₃ is synthesized by amidation of Boc-NH-PEG_2k-PBLA₈₅ and C₁₁F₂₃-COOH. First, the carboxyl group of C₁₁F₂₃-COOH was activated. 1.60 g of C₁₁F₂₃-COOH (2.60 mmol, 10 eq), 0.30 g of NHS (2.60 mmol, 10 eq), and 0.50 of EDC•HCl (2.60 mmol, 10 eq) were dissolved in 20 mL of distilled CHCl₃ in a 50 mL Schlenk flask under argon protection. The reaction was stirred for 12 h at room temperature. Afterwards, 50 mL of anhydrous DMSO containing 5.05 g of Boc-NH-PEG_2k-PBLA₈₅ (0.26 mmol, 1 eq) was added into the mixture. Then, 20 μL of distilled triethylamine was added and the reaction was allowed to proceed for another 2 days. Finally, the solution was dialyzed (MW cut-off: 3500 Da) against methanol for 2 days and dried under vacuum to yield white powder Boc-NH-PEG_2k-PBLA₈₅-C₁₁F₂₃ (5.01 g, 0.25 mmol, 95% yield).

Synthesis of Boc-NH-PEG_2k-PAsp(DEA-co-His-co-DIP)₈₅-C₁₁F₂₃ (Boc-NH-PEG_2k-PDHD)

A total of 5.00 g of Boc-NH-PEG_2k-PBLA₈₅-C₁₁F₂₃ (0.25 mmol) was dissolved in 20 mL of anhydrous DMSO under argon protection. Then, 0.58 g of DEA (5.00 mmol, 20 eq) was added and the solution was allowed to react for 8 h at 35 °C. Next, 0.28 g of His (2.50 mmol, 10 eq) was added and continued to stir for 12 h. Following the addition of DIP (1.80 g, 12.50 mmol, 50 eq), the reaction was allowed to proceed for an additional 12 h under identical conditions. Subsequently, the product was subjected to dialysis against methanol for 48 h, utilizing a membrane with a molecular weight cut-off of 3500 Da. The dialyzed solution was then concentrated via rotary evaporation, resulting in the isolation of Boc-NH-PEG_2k-PAsp(DEA-co-His-co-DIP)₈₅-C₁₁F₂₃, abbreviated as Boc-NH-PEG_2k-PDHD (4.89 g, 0.22 mmol, 90% yield).

Synthesis of Fmoc-Lys-PEG_2k-PDHD

First, the protective group of Boc-NH-PEG_2k-PDHD was removed. In brief, 5.00 g of Boc-NH-PEG_2k-PDHD (0.22 mmol) was dissolved in 20 mL of trifluoroacetic acid (TFA) at room temperature. After stirring for 2 h, TFA was removed by rotary evaporation and the residue was dissolved in DMSO. The solution was basified with 50 μL of triethylamine and dialyzed (MW cut-off: 3500 Da) against methanol for 48 h, then dried under rotary evaporation to yield NH₂-PEG_2k-PDHD. Afterwards, the carboxyl group of Fmoc-Lys was activated and then reacted with NH₂-PEG_2k-PDHD, using the same preparation method for Boc-NH-PEG_2k-PBLA₈₅-C₁₁F₂₃. Finally, white powder Fmoc-Lys-PEG_2k-PDHD was obtained (4.31 g, 0.19 mmol, 85% yield).

Synthesis of (Fmoc-ABU)₂-PEG_2k-PDHD

Similarly, the protective group of Fmoc-Lys-PEG_2k-PDHD was removed. A total of 5.00 g of Fmoc-Lys-PEG_2k-PDHD (0.22 mmol) was dissolved in 40 mL of anhydrous DMSO, followed by the addition of 10 mL of piperidine while maintaining a piperidine concentration of approximately 20% throughout the solution. After stirring for 0.5 h at room temperature, the solution was dialyzed (MW cut-off: 3500 Da) against methanol for 24 h, then dried under rotary evaporation to yield Lys-PEG_2k-PDHD. Afterwards, the carboxyl group of Fmoc-ABU-OH was activated and then reacted with Lys-PEG_2k-PDHD, using the same preparation method for Fmoc-Lys-PEG_2k-PDHD as mentioned above. Finally, white powder (Fmoc-ABU)₂-PEG_2k-PDHD was obtained (4.34 g, 0.19 mmol, 88% yield).

Synthesis of the enzyme and acid dual-responsive polymer BEAGA₂-PEG_2k-PDHD

First of all, the protective group of amine in the polymer (Fmoc-ABU)₂-PEG_2k-PDHD (4.57 g, 0.20 mmol) was removed by the addition of piperidine. Then, the carboxyl group of Boc-Glu was activated and reacted with the exposed amino groups in DMSO. The solution was dialyzed (MW cut-off: 3500 Da) against methanol for 24 h, and dried under rotary evaporation to yield (Boc-Glu-ABU)₂-PEG_2k-PDHD. The obtained polymer was next dissolved in TFA to remove the Boc group. After purification, the enzyme and acid dual-responsive polymer BEAGA₂-PEG_2k-PDHD was finally obtained. The relevant experimental procedures involved have been described above and will not be detailed here (4.05 g, 0.17 mmol, 85% yield).

Synthesis of N₃-PEG_3.4k-PDHD

Synthesis of the acid-responsive polymer N₃-PEG_3.4k-PDHD

The synthetic process of N₃-PEG_3.4k-PDHD was outlined in Supplementary Fig. 10 and was same as that of Boc-NH-PEG_2k-PDHD. Briefly, N₃-PEG_3.4k-NH₂ was used as a macroinitiator to trigger the ring-opening polymerization of BLA-NCA to obtain the diblock copolymer N₃-PEG_3.4k-PBLA₈₅. Then the carboxyl group of C₁₁F₂₃-COOH was activated and reacted with N₃-PEG_3.4k-PBLA₈₅ to yield N₃-PEG_3.4k-PBLA₈₅-C₁₁F₂₃. After aminolyzed by DEA, His, and DIP at a molar ratio of 20:10:55, the white powder N₃-PEG_3.4k-PAsp(DEA-co-His-co-DIP)₈₅-C₁₁F₂₃, abbreviated as N₃-PEG_3.4k-PDHD, was finally obtained.

Preparation of nanoprobes

Considering the pharmacodynamic concentrations of R848 and ILD as well as the low encapsulation rate of R848, we used ILD and R848 as the feeding ratio of 5:1 (m/m) to prepare the nanoprobe BEAGA/ApoE-PDHD@ILD & R848^29,47. In detail, a 1:4 molar ratio of N₃-PEG_3.4k-PDHD and BEAGA₂-PEG_2k-PDHD (a total weight of 40 mg) as well as 1 mg of R848 were dissolved in 0.5 mL of DMSO. Then, 200 μL of deionized water containing 5 mg of ILD was slowly dropped into the solution under sonication in an ice bath, followed by the addition of 200 μL of PFP/PFB (v/v = 2:1)²⁶. Subsequently, the emulsions were dripped into 20 mL of deionized water, while being sonicated in an ice bath to maintain a low temperature. Large aggregates were removed using a syringe filter with a pore size of 0.45 μm. The filtered mixture was then dialyzed against PBS (pH 7.4) at 15 °C for 12 h, ensuring the effective removal of DMSO and any unreacted polymer. Afterwards, ApoE-DBCO, in an equimolar amount to N₃-PEG_3.4k-PDHD, was introduced into the solution and allowed to incubate for an additional 4 h to facilitate conjugation. The resulting solution was concentrated and purified by washing it three times with PBS (pH 7.4) using a MILLIPORE Centrifugal Filter Device, set at a molecular weight cut-off of 100 kDa, a rotational speed of 18 g, and a temperature of 4 °C. The solution was then passed through a syringe filter with a pore size of 0.45 μm, eliminating any remaining large aggregates. The enzyme and acid programmed responsive nanoprobe BEAGA/ApoE-PDHD@ILD & R848 was finally yielded. Similarly, polymer N₃-PEG_3.4K-PDHD was treated likewise to obtain BBB-bindable nanoprobe ApoE-PDHD@ILD & R848 after adding ApoE-DBCO. And BEAGA₂-PEG_2K-PDHD was used to prepare enzyme-responsive nanoprobe BEAGA-PDHD@ILD & R848.

Characterization of polymers and nanoprobes

¹H NMR and ¹⁹F NMR spectra were recorded on a Varian Unity 400 MHz Spectrometer (Bruker, Switzerland) in various deuterated solvents. Dynamic light scattering (DLS) on a 90 Plus/BI-MAS instrument (Brookhaven Instruments Corporation, USA) was used to measure the size and zeta potential of nanoprobe at pH 7.4 or 6.5. Transmission electron microscopy (TEM) images were obtained from a model H-7650 TEM (Hitachi Ltd, Tokyo, Japan) operated at 120 kV. The samples were prepared by depositing a precise drop of the sample solution (10 μL, 1 mg/mL) onto a copper grid that had been previously coated with an amorphous carbon layer. Following this, a minute quantity of phosphotungstic acid aqueous solution (2 wt%) was dispensed onto the grid surface. After allowing for a brief interaction period of 1 min, excess solution was gently blotted away using a piece of filter paper. The copper grid was left to dry overnight within a desiccator, maintaining a controlled, moisture-free environment, prior to being subjected to observation.

Next, the GGT-catalyzed surface charge enhancement of BEAGA/ApoE-PDHD was investigated. GGT (1, 5, or 10 U/mL) was added to the solution of BEAGA/ApoE-PDHD (2 mg) in 1 mL of PBS solution. The solution was dialyzed (MW cut-off: 3500 Da) against 50 mL of PBS (pH = 7.4) with gentle shaking (75 rpm) at 37 °C in an incubator shaker (Shanghai Yiheng Scientific DKZ, China). At certain time intervals (0.5 h, 1 h, 3 h, 6 h, 9 h, and 12 h), a 20 μL aliquot was taken out from the dialysis bag and measured by the 90 Plus/BI-MAS instrument.

The in vitro ultrasound imaging was executed utilizing a clinical ultrasound scanning system (Acuson Sequoia 512, Siemens, USA) operating under the Power Doppler mode. For this purpose, 1 mL aliquots of the nanoprobe solution (5 mg/mL), were dispensed into designated sample wells within a custom-fabricated 2% (w/v) agarose phantom, with the pH adjusted to either 7.4 or 6.5 to assess the impact on imaging capabilities. The Power Doppler imaging was achieved by employing a broadband 15L8-w high-frequency linear transducer, operating at a frequency of 10 MHz and transmitting a power level of 18 dB48⁴⁸. The focal zone was precisely positioned at the center of each well to ensure optimal imaging resolution. Horizontal scans of the nanoprobe distribution were then acquired using the agarose gel model as an imaging medium.

Afterwards, the content of the sonosensitizer ILD encapsulated in nanoprobe was measured using a Unico UV-2000 UV-vis spectrophotometer (Shanghai, China) at the wavelength of 755 nm based on the standard absorption curve of ILD. The gadolinium (Gd) content was determined by an Optima 5300 DV ICP-AES (Perkin Elmer® Inc., USA) at the wavelength of 342 nm. The PFP/PFB content was detected using a gas chromatography-mass spectrometry analysis system (GC-MS, Trace GC 2000-DSP, USA) based on our previous study²⁶. The loading content of R848 in nanoprobe was investigated at the wavelength of 254 nm by high-performance liquid chromatography (HPLC) equipped with a 1260 Infinity II LC System (Agilent Technologies Inc., Santa Clara, CA, USA). Briefly, the pre-weighed freeze-dried nanoprobe was redissolved in 0.1 M HCl solution. R848 was extracted after the addition of methanol. The organic phase was separated by centrifugation at 3100 × g for 15 min and analyzed with a C18 column (50 mm × 2.1 mm, 1.7 μm) at 45 °C. The mixture of acetonitrile and 0.1% formic acid solution (95: 5, v/v) was chosen as mobile phase at a flow rate of 0.3 mL/min.

Furthermore, the in vitro drug release behavior of nanoprobe was analyzed at 37 °C. Two mL of solution containing 20 mg of nanoprobe was adjusted to pH 7.4 or 6.5 and introduced into a dialysis bag (MW cut-off: 14 kDa). The dialysis bag was placed into 20 mL of fresh PBS (pH 7.4 or 6.5) with gentle shaking (75 rpm) at 37 °C in an incubator shaker. Insonation was applied if needed (2 MHz, 2.0 W/cm², 20% duty cycle, 2 min). At specific time intervals (0.5 h, 1 h, 2 h, 4 h, 6 h, 8 h, 12 h, and 24 h), 3 mL aliquots of the solution external to the dialysis bag were withdrawn for UV-vis spectroscopic analysis, promptly followed by replenishment with an equal volume of fresh buffer solution. Subsequently, the cumulative percentages of the released drugs were graphically represented against time.

Finally, the MRI sensitivity of the nanoprobe was evaluated by measuring the T1 relaxation time on a clinical MR system (Ingenia 3.0 T; Philips Medical Systems, Best, Netherland). Nanoprobe dissolved in PBS at pre-designed concentrations was added to a 96-well detachable plate. An inversion recovery spin echo sequence was carried out with the following parameters: TR = 1500 ms; TE = 20 ms; FOV, 80 mm × 80 mm; matrix, 228 mm × 289 mm; voxel, 0.4 mm × 0.4 mm; slice thickness, 2 mm; reconstruction matrix, 512; IR delay, 400 ms; NSA, 1. Regions of interest (ROIs, mean size, 30 mm²) were checked to obtain the T1 relaxation times. Furthermore, the T1 relaxivity value (r₁) was derived by computing the slope of the linear plots constructed by plotting the reciprocal of T1 (1/T1) against the Gd concentration, employing a linear least-squares regression analysis method.

Cell culture

The mice glioma cells (G422), rat glioma cells (C6, Catalog No. CCL-107 (ATCC)), human glioma cells (U87, Catalog No. HTB-14 (ATCC)), and luciferase protein gene recombinant mice glioma cells (G422-Luc) were purchased from Tongpai Biotechnology Co., Ltd (Shanghai, China). Mouse brain microvascular endothelial cells (bEnd3, Catalog No. CRL-2299 (ATCC)), human brain microvascular endothelial cells (HBMEC, Catalog No. #1000 (ScienCell)), rat brain microvascular endothelial cells (RBMEC, Catalog No. #R1000 (ScienCell)), and mouse leukemia cells of monocyte macrophage (RAW 264.7, Catalog No. TIB-71 (ATCC)) were obtained from Zhong Qiao Xin Zhou Biotechnology Co., Ltd (Shanghai, China). The GGT-shRNA-Lentivirus (sequence (5’ to 3’): GGTTGGCCAATACCACCATGT) used to construct stable GGT knockdown bEnd3 cells (bEnd3-GGT/KD) were designed by Suzhou Jima Gene Co., Ltd. (Suzhou, China). G422 and G422-Luc cells were cultured in RPMI 1640 medium. C6, bEnd3, U87, and RAW 264.7 cells were cultured in a DMEM (low glucose) medium. HBMEC cells were cultured in an endothelial cell medium and RBMEC were cultured in an endothelial cell medium-rat. All cell lines were tested negative for mycoplasma contamination by using MycAwayTM-Color One-Step Mycoplasma Detection Kit. The cells were cultured at 37 °C in various mediums supplemented with 10% FBS and 1% penicillin-streptomycin in a humidified incubator of 5% CO₂. And the cells for all experiments were in logarithmic growth phase.

Western blot assay

BEnd3, bEnd3-GGT/KD, HBMEC, RBMEC, G422, and RAW 264.7 cells were seeded in a 6-well plate and cultured overnight. The cells were separated from culture medium and washed with PBS three times when the cell density reached 80%. The protein samples were prepared by adding loading buffer and denatured at 100 °C for 10 min. Then the sodium dodecyl sulfate polyacrylamide gel electrophoresis (SDS-PAGE) gel was used to load protein samples and ran at 90 V for 2 h. Subsequently, the proteins were efficiently transferred from the gel onto a PVDF membrane utilizing a dedicated transfer buffer. To minimize non-specific binding, the membrane was then blocked with 5% bovine serum albumin (BSA) for a duration of 1 h at ambient temperature. Following blocking, the membrane was incubated overnight at 4 °C with gentle agitation in the presence of the primary anti-GGT antibody. Post-incubation, the membrane was washed three times with TBST buffer to remove unbound antibodies. Next, the secondary antibody, which was conjugated to HRP, was diluted in the blocking buffer and incubated with the membrane for 1 h at room temperature. The membrane was again subjected to three washes with TBST buffer. The proteins were visualized using the appropriate enzyme substrate solution according to the manufacturer’s instructions and imaged by a chemiluminescence detection system.

In vitro BBB model and cellular internalization studies

An in vitro BBB model was constructed to verify the efficiency of various nanoprobes crossing BBB. bEnd3 cells were seeded into polycarbonate 24-well minicell® Hanging Cell Culture Insert of 0.4 μm pore size (Millipore, USA) at a density of 5 × 10⁴ cells per well. The transepithelial electric resistance (TEER) was monitored every day using an epithelial voltohmmeter (Millicell-RES, Millipore, USA). The tight junctions of the in vitro model could be regarded to mimic the real BBB when the TEER values reached a stable level²⁸. The minicells with bEnd3 cells were hung upon the wells of a 24-well plate while G422 cells were cultured in the plate. The nanoprobes, i.e., BEAGA/ApoE-PDHD@ILD & R848, ApoE-PDHD@ILD & R848, and BEAGA-PDHD@ILD & R848, were added into the medium of minicells and incubated at 37 °C. Insonation was applied if needed (2 MHz, 2.0 W/cm², 20% duty cycle, 5 min). After incubation for another 2 h, the nanoprobes internalized in G422 cells after crossing BBB constructed by bEnd3 were observed under CLSM and analyzed using flow cytometry assay.

To evaluate the BBB-crossing efficiency of various nanoprobes on other cellular models, the transwell filter with a mean pore size of 0.4 µm was seeded with a compact HBMEC monolayer or a compact RBMEC monolayer, and the bottom plate was correspondingly seeded with a U87 cell monolayer or a C6 cell monolayer. The in vitro BBB models were treated likewise. The nanoprobes internalized in U87 cells or C6 cells after crossing BBB constructed by HBMEC or RBMEC were observed under CLSM and analyzed using flow cytometry assay.

Penetration of nanoprobes in 3D cell spheroids

The 96-well plate was pre-coated with agarose. bEnd3-GGT/KD cells with stable GGT knockdown were established using GGT-shRNA-Lentivirus according to our previous study⁴⁹. In detail, bEnd3 cells were seeded in a 6-well plate and incubated overnight to reach 60-70% confluency. The GGT-shRNA-Lentivirus was diluted in DMEM with 10% FBS and supplemented with polybrene at a final concentration of 5 µg/mL to enhance transduction efficiency. The virus-containing medium was added to the cells and incubated for 24 h. Afterwards, the medium was replaced with fresh DMEM, and the cells were incubated for an additional 48 h. To select for successfully transduced cells, puromycin was added to the medium at a concentration of 1 µg/mL, and the selection was continued for 14 days until non-transduced cells were eliminated. The knockdown of the GGT gene was then verified by western blot to evaluate protein expression.

Next, L929 cells and bEnd3-GGT/KD cells were seeded in the 96-well plate at a ratio of 3:1 for 7 days to prepare the cell spheroids. The culture medium was changed every 3 days. The 3D cell spheroids were incubated with BEAGA/ApoE-PDHD@ILD & R848 pre-treated with various concentrations of GGT when the spheroids grew up to 500 μm. LFUS irradiation was carried out if required. After washing with PBS, the received cell spheroids were imaged under the CLSM.

Intracellular ROS generation

ROS generation of nanoprobes under insonation was determined by DCFH-DA. G422 cells were seeded at a density of 1.0 × 10⁶ cells per well into a 12-well plate and cultured at 37 °C overnight. After incubated with saline, BEAGA/ApoE-PDHD@R848, BEAGA/ApoE-PDHD@ILD and BEAGA/ApoE-PDHD@ILD & R848 at an ICG concentration of 50 μg/mL for 2 h, insonation was applied to the BEAGA/ApoE-PDHD@ILD and BEAGA/ApoE-PDHD@ILD & R848 treatment groups (2 MHz, 2.0 W/cm², 20% duty cycle, 5 min). 1 h later, 1 mL of DCFH-DA was added and incubated with G422 cells for 30 min. After washing with fresh PBS three times, the intracellular ROS was observed under CLSM and quantitatively investigated by flow cytometry analysis.

Cell viability and apoptosis assay

The cell viabilities against nanoprobes were measured using MTT assay. G422 cells were seeded onto a 96-well plate at a uniform density of 5 × 10³ cells per well. The cells incubated overnight were treated with saline, BEAGA/ApoE-PDHD@R848, BEAGA/ApoE-PDHD@ILD, and BEAGA/ApoE-PDHD@ILD & R848 at an ICG concentration of 50 μg/mL. After further incubation for 12 h, insonation was applied if needed (2 MHz, 2.0 W/cm², 20% duty cycle, 5 min). 12 h later, the cell viabilities were determined by Cell Counting Kit-8 (CCK8). Meanwhile, the cells were stained with Calcein-AM/Propidium Iodide (PI) to detect live and dead cells under CLSM.

For cell apoptosis assay, G422 cells were seeded in a 12-well plate at the density of 1 × 10⁶ cells per well and incubated overnight. Various formulations including saline, BEAGA/ApoE-PDHD@R848, BEAGA/ApoE-PDHD@ILD, and BEAGA/ApoE-PDHD@ILD & R848 (ICG dose: 50 μg/mL) were added and incubated for another 12 h. Insonation was applied to the BEAGA/ApoE-PDHD@ILD and BEAGA/ApoE-PDHD@ILD & R848 treatment groups (2 MHz, 2.0 W/cm², 20% duty cycle, 5 min). 12 h later, cells were stained with Annexin V-FITC/PI dyes and further quantitatively measured by flow cytometry (FCM, NovoCyte 3000, Agilent).

Measurement of mitochondrial potential

Mitochondrial membrane potential was monitored by the fluorescent probe JC-1. G422 cells were treated in the same way as the apoptosis assay and collected. The JC-1 working solution was added and incubated for 10 min without light⁵⁰. After centrifugation (350 × g) for 5 min at room temperature, the supernatant was discarded. The cells were washed twice with 2 mL of medium and resuspended in 400 μL of medium for flow cytometry analysis.

For CLSM analysis, G422 cells were stained with JC-1 working solution for 15 min at 37 °C. Afterwards, PBS rinsing was carried out to completely remove the needless JC-1 dye. The cells were stained with DAPI for CLSM observation (DAPI: Ex/Em = 405/455 nm; monomer: Ex/Em = 514/529 nm; J-aggregate: Ex/Em = 585/590 nm).

Expression level of calreticulin (CALR), adenosine triphosphate (ATP), and high mobility group B1 (HMGB1) in vitro

The expression of CALR was analyzed through immunocytochemistry and subsequently visualized under CLSM. Prior to the analysis, G422 cells were seeded at a density of 1 × 10⁶ cells/well in a 12-well plate and allowed to adhere and proliferate overnight under optimal culture conditions. The cells were treated with saline, BEAGA/ApoE-PDHD@R848, BEAGA/ApoE-PDHD@ILD, and BEAGA/ApoE-PDHD@ILD & R848 for 12 h. Insonation was applied to the BEAGA/ApoE-PDHD@ILD and BEAGA/ApoE-PDHD@ILD & R848 treatment groups (2 MHz, 2.0 W/cm², 20% duty cycle, 5 min). Afterwards, the cells were fixed with 4% paraformaldehyde to preserve their structural integrity, followed by a blocking step to minimize non-specific binding. The cells were incubated with the anti-calreticulin antibody at 4 °C overnight. The FITC secondary antibody was then used to stain cells for 1 h. Afterwards, the actin was stained with the Actin-Tracker at a 1/100 dilution for 1 h and the nuclei were labeled with DAPI. The cells were finally observed using CLSM.

On the other hand, cells were treated in the same way to determine the expression level of ATP and HMGB1 through enzyme-linked immunosorbent assay (ELISA). Cell supernatants were collected by centrifugation at 12,400 × g for 20 min and analyzed with an ATP ELISA Kit or HMGB1 ELISA Kit following the manufacturer’s protocol.

Bone marrow-derived dendritic cells (BMDCs) maturation

First of all, a Liquid Chromatograph Mass Spectrometer (LCMS-2020, SHIMADZU, Japan) was carried out to verify the intactness and successful release of R848 after G422 ICD. The supernatant of G422 cells after treatment of BEAGA/ApoE-PDHD plus LFUS irradiation mentioned above was collected and dried up. The residue was dissolved in methanol, filtrated, and detected using the LC-MS. For HPLC measurement, a mixture of acetonitrile and 0.1% formic acid solution (95: 5, v/v) was used as an eluent at a flow rate of 0.3 mL/min. The content of R848 was investigated at the wavelength of 254 nm. A standard solution of R848 at a concentration of 10 μg/mL was employed as the control group. The experiment was performed using a C18 column (Thermo Hypersil GOLD) at the temperature of 45 °C. The mass spectrum of R848 in G422 cell supernatant after HPLC separation was obtained based on the following parameters: In Source Type, H-ESI; Spray Voltage, static; Positive Ion (V), 3200; Sheath Gas (Arb), 40; Aux Gas (Arb), 5; Ion Transfer Tube Temp (°C), 300; Vaporizer Temp (°C), 350. Experiments were repeated three times. Data were analyzed using Xcalibur (Ver.4.3) software.

Afterwards, the 6-week-old KM mice were euthanized and sterilized with 75% ethanol. The femurs and tibias of the mice were removed and the muscle was dissected from the bone. The bone marrow was flushed with the cold RPMI 1640 medium and filtrated through a 70-μm cell strainer. The bone marrow cells were collected by centrifuging at 350 × g for 5 min after the lysis of red blood cells. Then, the bone marrow cells were resuspended and cultured at a density of 1 × 10⁶ cells per well with the completed RPMI 1640 medium in the presence of 20 ng/mL GM-CSF. The cell culture media was half-changed every 3 days. The BMDCs were collected on the 6th day from the well by gently pipetting up and centrifuging at 300 × g for 5 min. The harvested BMDCs were seeded in a new plate and incubated with the supernatant of glioma cells receiving treatments of saline, BEAGA/ApoE-PDHD@R848, BEAGA/ApoE-PDHD@ILD and BEAGA/ApoE-PDHD@ILD & R848 under LFUS irradiation. BMDCs that have not been treated with glioma cell supernatant were served as a control group for comparison (no stimulus group).

The maturation of BMDCs was analyzed using FCM and ELISA. For FCM analysis, the BMDCs were collected and incubated with anti-CD16/32 antibody for 30 min to block Fc receptors. And then the cells were stained with fluorescently labeled antibodies such as CD11c, CD80, and CD86. After rinsed and resuspended, the cells were analyzed by FCM to calculate the percentage of maturation markers. Meanwhile, the cell supernatants were collected to measure the levels of cytokines including IL-12 and IFN-β using the ELISA Kits according to the manufacturer’s protocol.

Animal models

Four-week-old female KM mice were purchased from Guangdong Medical Laboratory Animal Center. G422-Luc cells were implanted into the brain striatum of mice to establish the orthotopic glioma model. In brief, mice were first anesthetized by injection of 2.5% pentobarbital sodium (3.5 mL/kg) intraperitoneally and restrained. 5.0 × 10⁵ G422-Luc cells resuspended in 5 μL of PBS were injected into the right striatum of mouse brain (2.0 mm lateral and 3.5 mm depth) at a speed of 0.5 μL/min using a mouse adapter. Mice with their wound sterilized and seamed were carefully housed in a specific pathogen-free (SPF) environment. To establish orthotopic U87 tumor-bearing nude mouse or C6 tumor-bearing rat model, U87 cells or C6 cells were respectively implanted into the brain striatum of 4-week-old female nude mice or 8-week-old female Sprague Dawley rats purchased from Guangdong Medical Laboratory Animal Center and treated likewise. The Ethics Committee stipulated a criterion of a maximum permissible tumor diameter of 2 cm, conjoined with a condition that the tumor’s weight ought not to surpass 10% of the total body weight of the mice. None of the tumor volumes of mice in the current study transgressed these regulations. During the experiment, all animals were subjected to regulated environmental conditions, including a precisely maintained temperature of 22 °C, humidity levels ranging between 40% and 50%, and a strictly adhered to light/dark cycle of 12 h each, with unrestricted access to both water and food.

In vivo biodistribution of nanoprobes

In vivo fluorescence imaging

The in vivo biodistribution of nanoprobes in tumor-bearing KM mice was first investigated through a small animal fluorescence imaging system (In-Vivo Imaging System FX Pro, Carestream Health Inc., New Haven, CT, USA). KM mice (n = 3) with G422 cells inoculated in their brain for 6 days were tail vein injected with BEAGA/ApoE-PDHD@ILD & R848, ApoE-PDHD@ILD & R848 or BEAGA-PDHD@ILD & R848 (500 μg/kg ICG), respectively. The hair of mice was removed. At pre-designed time points (pre, 1 h, 3 h, 6 h, 12 h, and 24 h), fluorescence images were recorded with an excitation wavelength of 720 nm and an emission wavelength of 790 nm. Subsequently, the mice were humanely euthanized, and their vital organs including the heart, liver, spleen, lungs, and kidneys, along with the brain, were excised for ex vivo fluorescence imaging. The brain tissues were further subjected to the preparation of frozen sections to investigate the distribution of nanoprobes in the brain. The in vivo biodistribution of nanoprobes in U87 tumor-bearing nude mice or C6 tumor-bearing rats was investigated through the same experimental procedure, followed by their brain tissues being subjected to prepare frozen sections.

In vivo MR imaging

MRI scan was next carried out to evaluate the in vivo imaging ability of nanoprobes on mice 6 days after tumor cell inoculation. Mice (n = 3) anesthetized by intraperitoneal injection of 2.5% pentobarbital sodium (3.5 mL/kg) were scanned on a 3.0 T MR scanner equipped with a 50 mm × 65 mm 8-channel phased-array mouse coil (Shanghai Chenguang Medical Technologies Co., Ltd., Shanghai, China). Subsequently, they were i.v. injected with BEAGA/ApoE-PDHD@ILD & R848, ApoE-PDHD@ILD & R848, or BEAGA-PDHD@ILD & R848 at a dose of 4.5 mg Gd/kg body weight. At pre-designed time points (pre, 1 h, 3 h, 6 h, 12 h and 24 h), a fast spin echo sequence was performed to acquire T1-weighted MR images: TR = 400 ms; TE = 11 ms; FOV, 60 mm × 60 mm; matrix, 248 mm × 246 mm; voxel, 0.24 mm × 0.24 mm; slice thickness, 1 mm; flip angle, 90°; NSA, 2.

Intravital real-time observation by two-photon CLSM

The real-time two-photon CLSM (Olympus FVMPE-RS, Japan) was applied to directly observe the processes of nanoprobes binding to the cerebral vessels and then crossing BBB on tumor-bearing mice. DiI was encapsulated into nanoprobes to make them visible under CLSM. Mice (n = 3) were anesthetized by intraperitoneal injection of 2.5% pentobarbital sodium (3.5 mL/kg). Their heads were restrained and polished using a hand-held cranial drill (RWD Life Science, China) under a dissection microscope to acquire a small skull region (~4 mm in diameter)⁵¹. The mice were then injected intravenously with DiI-loaded nanoprobes (500 μg/kg DiI), i.e., BEAGA/ApoE-PDHD@DiI, ApoE-PDHD@DiI and BEAGA-PDHD@DiI, and dripped with a drop of water on the thinned-skull cranial window. Next, the height of the objective lens was exactly adjusted to touch the water droplet on mice placed on a thermoplate of CLSM. A pre-programmed program was carried out at pre-designed time points (30 min, 60 min, 90 min, and 120 min). Images were acquired from Olympus FV1000 software and analyzed by Image J.

Anticancer efficacy of nanoprobes

In vivo anticancer effect

The in situ G422-Luc tumor-bearing mice were randomly assigned to 6 groups (n = 5) after tumor cells transplanted for 6 days, and received treatments of saline (control), R848 and ILD co-loaded BEAGA-PDHD (BEAGA-PDHD@ILD & R848), R848 and ILD co-loaded ApoE-PDHD (ApoE-PDHD@ILD & R848), R848 loaded BEAGA/ApoE-PDHD (BEAGA/ApoE-PDHD@R848), ILD loaded BEAGA/ApoE-PDHD (BEAGA/ApoE-PDHD@ILD), R848 and ILD co-loaded BEAGA/ApoE-PDHD (BEAGA/ApoE-PDHD@ILD & R848) at an ICG dose of 5 mg/kg body weight, respectively. Different formulations were intravenously administered into mice every 3 days for a total of 4 times. Mice in all treatment groups were exposed to ultrasonic insonation (2.0 MHz, 2.0 W/cm², 20% duty cycle, 10 min) at 12 h post-administration of nanoprobes. Mice were raised for overall survival observation with their body weights recorded and growth rates of intracranial glioma cells monitored by bioluminescence imaging.

In another separate experiment, mice subjected to the same treatment strategy were sacrificed 17 days after tumor cell inoculation, followed by their brains being excised, fixed with 4% paraformaldehyde, sliced coronally into sections, and finally subjected to hematoxylin/eosin (H&E) staining and immunohistochemistry (IHC) staining of Ki67.

Furthermore, 4-week-old tumor-free KM mice were randomly assigned to 6 groups (n = 3) and received the same treatment strategy as that of the tumor-bearing mice. Then, mice were perfused with ice-cold PBS and 4% paraformaldehyde (PFA) to prepare paraffin sections of brains. The sections were subjected to immunofluorescence staining using rabbit anti-Iba1 or rabbit anti-GFAP or stained with methylene blue according to standard protocol.

Evaluation of tumor-infiltrating immune cells and memory CD8⁺ T cells

The brain tumors were excised from the mice receiving different treatments and dissociated into single-cell suspensions through the mechanical method. The cells were filtrated through a 70-μm cell strainer and washed with cold PBS buffer to remove cell clumps and debris. After blocking Fc receptors, the cells were incubated with surface marker antibodies including CD45, CD3, CD4, and CD8 in the dark for 30 min at 4 °C. Then the cells were washed with the FACS staining buffer to remove the unbound antibodies, and subjected to intracellular staining of nuclear Foxp3 protein according to the manufacturer’s protocol. After fixation and permeabilization, the cells were incubated with the anti-Foxp3 antibody for 1 h at 4 °C. The unbound antibody was removed by centrifuging at 450 × g for 5 min. In addition, the DCs were stained with surface markers of CD45, CD11c, CD80 and CD86. To identify other myeloid populations such as neutrophils and tumor-associated macrophages (TAMs), the single-cell suspensions were stained with the antibody cocktails including CD45, CD11b, Ly-6G, F4/80, CD80 and CD206. The immune cell populations were identified using FCM. For memory CD8⁺ T cell detection, the spleens of mice (n = 3) were harvested and dissociated into single-cell suspensions. The splenocytes were stained with surface markers of CD3, CD8, CD44 and CD62L.

Clinical human specimens

Human hepatoma tissue sections and human glioma tissue microarray sections were obtained from Shanghai Outdo Biotech Co., Ltd. (Shanghai, China). The human tissues were incubated with anti-GGT antibody at a 1:1000 dilution to detect the expression of GGT or incubated with anti-LDLR antibody at a 1:100 dilution to detect the expression of low-density lipoprotein receptor (LDLR) by IHC staining.

Statistics and reproducibility

The experiments including TEM observation, western blot analysis, immunohistochemical assessments of GGT and CD8⁺ T cells expression, two-photon CLSM examination, dual staining with Calcein-AM and PI for viability analysis, histological analysis of tumor tissues, and CLSM-based visualization of nanoprobe internalization by tumor cells and 3D cell spheroids, intracellular ROS generation, nanoprobe distribution in brain tissue sections, alterations in mitochondrial membrane potential, and CALR exposure in tumor cells were repeated three times. All remaining experiments were repeated at least threefold to ensure reproducibility and statistical significance. The investigators were not blinded to allocation during experiments and outcome assessment. Results were expressed as the means ± standard deviation (SD). Statistical analyses were performed using GraphPad Prism 6 (GraphPad Software, Inc., La Jolla, CA, USA). Comparison between groups was calculated by the two-sided unpaired t-test. A log-rank (Mantel–Cox) test was conducted to compare the survival curves. For all graphs, *p < 0.05; **p < 0.01; ***p < 0.001; and ****p < 0.0001.

Reporting summary

Further information on research design is available in the Nature Portfolio Reporting Summary linked to this article.

• SEO Powered Content & PR Distribution. Get Amplified Today.
• PlatoData.Network Vertical Generative Ai. Empower Yourself. Access Here.
• PlatoAiStream. Web3 Intelligence. Knowledge Amplified. Access Here.
• PlatoESG. Carbon, CleanTech, Energy, Environment, Solar, Waste Management. Access Here.
• PlatoHealth. Biotech and Clinical Trials Intelligence. Access Here.
• Source: https://www.nature.com/articles/s41467-024-54382-z